Description :
From Genome Similarity Track
Location :
Scaffold_157:20783- 27414
Transcript NameFunction/comments
Physo_143895reverse transcriptase

Sequence
6631 bases(100 bases per row)
GCAGCCCCCTTGCGACTTAGTCGCACCCGTGGGCGCTCACCCACCAGGCTCCGCCGCCTCCGAGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGT
CCCGTGCGCCGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTCGTCGACTCACGTCGTGTCCGGGTAGCCCTTCCATTTGACTTCGA
ACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCACCCTTCGCGCACGTTCACTATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGACTTC
CCAGCTATCCTCCGGCAAGAGCTCCACGTCGAAGTCGAAGCGCTCCTCGGTCGGCACCGCCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGC
TTCAGCCTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGTCTCGAGGCGCACTGCGAACGCGCTGACCAGCTCGGCGACGCGGAAGG
GTCCGTGCCACATGTGGGCGAGCTTCGCATACCCCGGCTTCACCCGATCCAGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTT
TTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACGCTTGTGCCCTTGCCACCTTGTAGTGTCGCTGGATACGGAGCCTCCAC
CGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGTGTCGCTTTTTTCCAGGGTCGACCGAGGATCCCAGCCATGCACTAAGAAGAACGGG
GTTTCGTTCCTCGTCCGGTCGTGCGACGTATTTAGCGCGAAGGTAAGACGCTCGGCGTATTCGTCCCAGTCCCGTTGGTCGACGTCCGCGATGTACATCT
TGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATATGCGAGCGTCGATCGCTGTCTCTGACCCATGAGTTTGCT
GAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGCCTCGCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCG
GCCACCGTCTGCGCGGTTCGTGACGCGTTCGCTTTTACCACGACGAACCTCGTGAAGAGGTCGCCCCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATG
CCGGCAACGACGGAATATGGTCCATGGCGATGACCTGGAACGGGTACGTCGCGACGATGTTGCCCGGCGACTCGCCATGGATGGTCGGCCGACCCTTTCC
CGTCTCACAGTCGGTGCATTCGCCGACGTAGCGCCGGACGCTTCTGAAGATCCCTGGCCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGACAATA
CCCTGGTGTCCGCCTTCCAGGCTCGCGTGATAGTGGTGGAGTACATCCTCCCGAAGAGTCTCCGGGATCACCAGCTTCATCATCACATCGCGATCCTCGG
CGGAATTGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAG
GTCTCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACGCGGATGCGGTCCAGGCGCAGTCGTTGCACCACT
AGCTCCTCCAGGACTTCTGGAGGTCGGCCCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGCCACCGCGAGGACTTGTGCTGTCCCGCGTCCCG
CGTCCATGGCCTTCCCGACGGGGTTATCTGCGCCGCTCGTTTTCGCGTCGAGATTTTCCGCGTCGAGACTGGCTGGAGACGCCATTTCGGGACTCGATGC
CCGTGGTCGGATGACTTCTTCCAAACGATTCAGCGTCTTCAGATCTTGAATCTGCTCGGGGCTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGT
CCAGCCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTCGTCGCAGCA
GCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATGACCAGGTTGGAGTCTCCGCACACGACGAGTCGGGTGACGTCGTCGAGTTC
CTCTAAAAGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCATGATCTCCCAGTTC
GGCAGCTGCCAAATGACGGCACTGTATGCTCCGCCCTCTCACTTCGCCTTAGCCGATCCGTCGGAGCTCAAGACGTGCAAGACCTCGTCGCGCTCCACGT
CGGGGACTGGAATGACTACAATCCTGGACGCCCGTTTCCGGGGGGCGATCTCTTCTAGCGCTGCGTCGACGAAGGCTCGCGGTGTAATGCTCGCGTCCAG
CGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGCAGACTTCCAGCTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCT
TTGGACCGGAACAACCAGGCGAGCGTCGTGGGACGTGTCAAGACGCGGACCGGTAGCATCGTGTAGCACTCGTTCAAGACGCGCAACAGGGCCAAGATCT
CCTTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAGCGCACGGCTGGTGAACTTCACAGGCATGTACACATCGTCGTGGACTTGCGTGAGCACCCC
TGAGATGGCCCAGACGCTGGCGTATACGATCACGACGTATTCTCGGTTCGCAGCGAAGTGCTTCAACATTGGGGTCTCGGCGCGTTTTGCCTTGAGCGCG
TCGAAGGCGCGCGTCGCGTGCGTCCACTTCTCATGTCCGCGGACTTCTGGACGCGTGGCGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGG
TTGCATATACCGCAAAGTCTGCAATGAAGCGGTGGTAGTAATTGAGGCTACCCAAGAACGATTGCAGGCCCTTGAGCGTGCGCAGGAACTCGAGCGACGT
CAGCGACTCCAGATTCTTCGGCTTCGCCTCGAGACCGAGTCCTGAAACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACA
CCGATGGAAAGTGCCACTGCTCGCAGACATCCAGCAAGCGTTCGACCTTCTCGCACATACCGTCCCACGACGTGCCCCCGATGAGGATGTCGTCGATGTA
CGACCTCCGTCCCAGAACGGAGTGAATACCTGGTTTCACCGGTTCGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCG
TAGAGCGCGTTGACGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACCGGCCGAATGGCATACGTAGCCATTCGTACAGTCCCATCGGCGTGATGAAGG
CCGAGATGAGCCGGGCCCGGTCTGTTATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAA
GTCGTTGACGAGCGGCATGGGGTAAACCATCAACTGCGTCAGGGCGTTGATGAGCCTGTAGTCAATGCAGAGCCGGATATCGACGCCGTTCTTCTTTATA
ATCACGACAATGGGCGACGCCCACGGTGACTTCGACTTCTAGATCATCCTCGCGCTCAGCAGTCCCTTGATCAAGTCGGCGACCTTCTCTCGGAACTCTG
GCGGGATTTTTCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACCACTCCCAGGGCCGCTGGTGGCAAGGCGTTACCCTTGCC
GATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGAGTCCCGTCGGCACGCCCACCTTCAGG
TCTTCGATCTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCGGACTCGAGCTCCTCGGCGAAGAGGTCAGATCCCTCGTGGATGAGGA
CTGCATCGTCTTCCTCCTGCTCATCCGGTTTTGCCTCGTCGCGTTCCGGCTCGGCGGGTTCTGGTCCGGCGAGTTTTGGCTCGGCGAGTTTTGACTCAGG
CGATTCCTTCATCGCAGCGCTTCCAGCCACTGTCGGAGGCCCATCGGGTTCCACTTCCACCGCCTCCTCGCCCGTTTTCTGCTTGTGGTCGTCGGGCGGC
ACCTCTACCCCGCTTCCCTTCGGCGCTCTCGCGACAGCCGCCAAACACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGGCGCAAAATG
GCTTTAGGCGTCGGGTATGAGGGGCGATTCGTCATCGGCCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCACGTCGCGCCGTACGCCAGAT
TCTGCCACTGCTGGTACCGGGAGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGTTGGCCGTCTGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTC
GAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGTAGGTACGTCTTCCTTCCGACTCTCCCTTTGACCAAGGTAGTCACCCACGACTCTGCCCGTGTC
ATCCACAGGAACGGCGCGTTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGTCTCACAGGTGTCTTGACGTTGACCGGGTGCGTCC
GTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCGTCCGCAGTGTCGATGCGCACTCCAGCGGGCAC
CATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTG
GTTCTCCCCATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCTGTGTCGATCAGGCAGCCTACCTCATGGTGTCCAGGATGGACACCTCGGCG
CCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGC
GTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCGTTC
TTGCGTGGTACGTTCCGGGTTGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTACTTCGTCACATATGCATAG
ACGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAATTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATT
CGGGTCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCCATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGC
TCCGTCGGGTGCTGGCCATCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGGGATGGCGACGTGAACCACAGTGGCGGCACCGCGGGCGGT
CGCGTCCCGAGTCGTCAGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGCCCCGCGACGAACAACCTGGCGCGTTCTTCGTCCTCCTCGTC
TTGGTCGTACTGGCGATCGTGTCGCGACTTTCGCGTTCCGAGTCGTACTCGTCTGACGCAACGGGAATCGCATGTACGGTGCGCGCCGGCTGAGTCGGCG
GAGTCGGCGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGGGTCTTCTTCTGGTGAGCCAATCCACGTTGTCGGGCGCGCAGCTTCTTCTCCAGCGCCTC
AGAGTCAGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGATTCAGTCGT
ACCATCGGCGTATGGGATGTTGACCCTCAAGCCCGCGACATTGAGTCGGTACAAGTAATCCAGAGGGGTCTCATCGGGGCGTTGAGCCGCATGGTAGTAG
CGGCTGGCCATTGACACGCCCTTGCCGCAGTACTGAACGCGGAATTGCTCCATCAGCTCGGTCCATGATTTCTTGACCTTCTTGGGCAGCTGAAGATACC
ATTGGCGTGCAGGGCGGCTCATCAGATCGCTGAACAGCCCGCACACTTCCTCCCCGGTCATCCCGTCGCGACGCGCAGCGGACTTCAGACGATTGAGCCA
CAGCCTAGCCTTCTCTTCGCCGGCATCTCGTCCCGAGAACTCCTTCAGCTCCGATGAAGCCGAGAGGCGAACTCTCGTAAGCCCGACACCGGCTGTCGCG
GTTGAGACCGCGGCCGCGGCTCTCGGCGTCCCGACGTCCACGTCAAACCGATCGTGGGGGTCCTCGTCCACGTCGCGTCAAGGTCCGGACCTCGACGAGG
GACGCGAGCTCACGGACTCCATCGCCACATC