Description :
From Genome Similarity Track
Location :
Scaffold_220:20782- 22781
Transcript NameFunction/comments
Albla_Nc14102030conserved hypothetical protein
Albla_Nc14102040conserved hypothetical protein

Sequence
1999 bases(100 bases per row)
TGTTACTAGAAGGTCGCTCGAACAAATCAGCACGATGAATTCGCAAAGCAGCGTCAAAAATAATGGTATGTGCCTAATTACCAGCAAGTTTTGCGTGCTG
ATGCAATGGCTTTGTGAATACAGAGCCTATCAATCCAAGATCTCAAACAGCTCCCAATATTCAACCAACCTTGAAAGGTTACAATCTTTTGTTTCCAGGG
CAATTTTGCGATGCATGCTACCAACTCTATCGTAGTCATGCGGCTATACAAACCCAAACTTTACTCACACAGTACGAATAACACCGGAGTCACATTACCG
ACCGCATTGAGTAGCATGAATGCATACCAGCAGGAATATGTCATATCCAACATGCTCTGTCTTCCGGATAGTTTCGGGCATGCTTATGGTTCTTCTAGGG
TCATCATCACCTCGTCACGATTCTTTTTGTAGACAAATATTCCTTGGAAATACATTCAGCAGTTATATAAGTGTCATCAATCCGTACAATTGTGACATTG
AAGAAGTCGGGCTAACGGTACTCTATTCAATAAGCGTGCGGTGAGAGAAGTAACACTCACATAGAGGTATTCAGGCGAACATTCAATGCGGTAATGATCG
TGTGGAGCTTCAGGATAATCGACAGTCTCGCACCGGGAAACTTCCACCACCTAATCCAACTCCTGTTCTGTCTGCCAATTCGTCTCTGGATATGGTGGTC
GATTTCCCTCTTTCTCAAGTTGGAAACCATGTGTAAGATGAAGCTATCATCAAGATGTCACATATTATGACGCTTATGATATGGATCACAGGCTTCGTGT
TGGTGTCAGCTATCTGGATCCGATTACAAAGGAGTCCAAATCATTGCGCAAATTCTACCGATTTGGTGTCCAAAATCCGCTGATACTGAATTTCAAGCAA
TCTCGAGCTCCATCGCAAGAAATCCTGATTGAAGCTCAAATTCGTAATGTATCGAGTTTGCCTTTATTCATCGATTCAATCAGATTTGAAGCGACATCAT
CCTTCACGCTGATGACCACTAAAAGAAGCTCTGAGTCAAGCCCGGCGGATTGTACTCAACCACAACCGGAAGACTCGGACTACACTATCGATACTATTTG
GCCTTCGCTGAAACAGCATCTTGCGCGTGGATCACCAACACTTCTCCAGCCGCAAGAAGAACTTCAGCGTATGTTTCGCTTATTCGAGTATGAACGCAAA
AAAATAGTCGACCCAGGTTTCCAGTCATCTCAGGTGCGCGAGAGTTGTTCGTAGATGCATAGCACTATCGCTGTATAATACGATTAAAGACTCTAGGGCG
ACTGCATGTGGGTTGGAAGACTAGCGTTGGTGAAGCTGGATCAGTACAGAGTCAGCCGATTGTTCGCAAATACGACACGATGCGAGACGTAAGCATTCGA
CTTCATTCCTTTCCAGAGCGATTGGTTGTAGAGAAAGTTTTCGTGGTGGAATGCACGATTGAGAATCACTCCACTCGGAACTTTGACATCCAGCTTCAGT
TCCGAAAGGAGAGCTTAGATGGAATCGTATGTTATTGCTTGACGCACCAAGTAGGTCATTTCCATATTTGCCTCAGTGTGTTTTTACTCAGCGTTTGAGC
TGCAGCATGTAGGCTCCCTAGTATCTGAAGCAAGCATTACGCTTCCATTGAAATTATTGCCACTCGAATGTGGCTTACAAGAGATTCGCGACATAGTTTG
CGTCGACCTACGAACCGGACAGGAATTTTTCCAGCAGCATCCAGTTCAACTCATGGTTTATACTACTACAGTCAAGGAGGCCTGAGTCTAATAATGCTCT
TCGTTTGATCGTCCACTCAAAGTTTTTCTACTGCACACAGCAACTGCTTGGTTTTCCACGCGATTGTGCAGATCCCAAGCATGTGAATTCGACTTCACCA
GCCATGAATACGTCTCCAATATCCACTTGAAATTGTTGCGCTTCCTCAAGGCGCACATACGTTCCCCATTCACTTTGTGTGTCATATAGCCAGTAACTT