Description :
From Genome Similarity Track
Location :
scaffold_267:20781- 27429
Transcript NameFunction/comments
g6530.t1 glycosyltransferase
g6531.t1hypothetical protein
g6532.t1 hypothetical protein PHYSODRAFT_301791

Sequence
6648 bases(100 bases per row)
GCAAACTACCCGCTGGAAATTCGTCTGTGGGCTTCGTACCGTGGTCAGACGTTGGCTCGTACAGTTCAGGGTATGATGCTCTATGAGGATGCTATCAAGA
TTCTACACTGGTTGGAAATTGGTTCGAGTCCCGGCAAGACTGCCGAGCAAAAGCAGGCCCAGCTTGAGGACATGGTGCGTCTGAAATTCTCGTACATTTG
TGCTTGTCAGGTGTACGGAAAGCATCGTGCAGAAAACAAACCCCAAGCCGATGATATCGACTACCTGCTGAAGACGTATCCGAATTTGCGTGTTGCCTAC
GTCGATACCATCGCGAGTGACGGTGGCAAGCAGTTTGATACTGTGCTTATCAAGAGTGAAGGCAACGAGATTGCCGAAGTGTATCGTTATGAACTGCCTG
GTGACCCGATTCTTGGTGAAGGTAAACCGGAGAACCAAAACAATGCGCTTCCGTTTACGCGTGGTGAATACCTGCAGACAATTGATATGAACCAGCAGCA
CTACTTCGAGGAGTGTCTGAAGATGCCGCAGCTTCTCGTGACCGCAGACTTGCACCCTTCAAAGAAACCTGTCTCGATTATTGGTATGCGTGAGCATATT
TTCACGGGTAACGCTTCGTCTCTGTCGAAGTTTAAATCGTGGCAGGAGCTTGTGTTCGTGACGCTGTCTCAACGTGTCCTGGCCGATCCACTGTACGTGC
GTATGCACTACGGTCACCCTGATATTTTCGACAAGATCATTGCGATTCCTCGTGGTGGTGTGTCTAAGGCTTCTAAGGGCATTAACTTGTCTGAGGATGT
GTTCGCTGGTTTCAACTCTACCCTTCGTGGCGGTGTGGTGACGCACGTTGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTTTCACAGATTTCT
ATGTTCGAGGGTAAGCTGGCAAATGGTGCCGGTGAAACTTCCCTGGCACGTGAGGCTCACCGCATGGGTCAGTTCATGGACTTCTTCCGTTTGAACTCGA
TGTACTACTCGCACACGGGGTTCTATTTCGCTACCTGGATGACTATTGTGACAACTTTCGTGTACATGTACTGCAAGGTGTACCTCGCCCTGGCTGGTGT
TCAGCAGCAAATTGTGTACGACATGAACTCGACTGCTGTCATTACTGACAATATTGCCAACAACTTCGACGAGCGTGTATTCACGGATTTGAAAGCTGTG
CTGAACACACAGTTCTACATTCAAGCCGGTACCTTTTTGATGCTTCCGCTGATGTGTGTGTACTTCGGTGAAGGTGGTTTTGTGCGCGGTATGACGCGTT
TCATCGATATGATTATCACGCTTGGTCCTGCCTTCTTCGTGTTCCAGGTCGGTACGACGATGCACTACTTCGATAACAATATTGTGCACGGTGGTGCCAA
GTACCAAGCCACGGGTCGTGGTTTCAAGATTTCTCGTGAAACGCTGGTGCTGCTGTACAAGGCTTACGCAAGTTCACACTATCGAAAGGCTTGGGAGCTG
ATCGGTTTGTGTCTGGTGTACCTGGTGTTTGGTAACTTCTACATTTGTCAGACCGATGCCTCCGCCAACGACAACACCTTTGCGTCCGACTACTGTGACA
CTTCTCAGGCTTACGGTGTGCAGACGTTCTCTGTGTGGTTCATTTCGATTCTGTGGGTGGTTGGTCCGTTCATGTTCAACAGTGACGGTCTTGATCTCAG
AAAAACGAAGGTGGATATCCAGCAATGGTGCATGTGGATGTTTGCCCCGGAAGATTACAAGGATGACGATCCGGCCAACAAGGGTGGCTGGGTTGGCTGG
TGGAAGGGAGATCTCGAACAGCTCCACGGCTCGAACATGATTTCGCGTGTGACGGTTATCCTTCGCGAGTGTCGCCATTTCCTGCTTATGTTTTACGTGG
CTACTCTGGAAACGTCTGATGTCATGTATGTTGCGTACTCGTTCGGCGCTGCTGTTGCGACGATTATCCTCCTCGGATTTTTCCACGGCATTGGCATGGG
CATGCGCTCCATGAGCCCCGTGTCACGCGCTGTGATCTACTTGGGCACTATTGCTATCTCGGTGACGGCATATTTCCTCGCTACATGGATCGTGCTGGAC
TGGACTTTTAAGTACTCGATGTCTCTGTTCTTCGCTTACGTAGCTGCTCTGTATGGCATTAACGAGTGTTTCCGCATGTGGAGCTTCCCGCACTCTTCGA
TCGCTGGTATCGCAGTGTTCCAGCAACTGCAGTTCCTGTTCGACTTCATCTTCTGCACGGGTATGATTATCCCGCTGATAATTTTGTCGTGCATTCCTTT
CTTGAACGTTATCCAGACGCGTATGATGTACAACGAAGGTTTCTCGAAGGTCATGTCCGCTTCGTCGCAGTACGCGTTCTCGCTTGCTGCTTTCATGGGT
GTTCTCGGCGGTGTTGGTGTTGGTTGGCTGTTTAACCTGCTGTCGACACTGGAGCAGTCTGCAAGTTTTGCGAGTTATGTCGTGACGTACGATGGCGTTC
TGAGTGGAAATGTCGGCGACGGTACTACAACATATATGCTTTATGGTGCCTGTGTTGTGGGCACGATCATCGCTGGTTTCTTGAACTACTTCGTGGGCCG
TCGTCTTTCTATCGTGGCTGGTGGTCTCTTTAGCACTCTCGGTATGGTGGCTGTCAGCGCCAACGATGACCTCCGTTCGACTCTTCTGATGCCTGGCATC
GGCCTTCTTGGTGCGTCCTGTGGTATCTTGCTTCCGTCGCTGGCGATTTATATCTTCGAAATTTCCACCAAGGAAATGCGTGGTAAGGCTATTCTGCTTC
TGGGCATGGGCTTCATCGCAGGTAGCTTGCTGGGTGGTATTTTCGCGACGGTGAACCAGTTGGGATGGATCTGGCAGACATTTGCTGCTTGCATCGTCAT
CGCTTTGGTAACTCCAGTGGTCAACGTGTTCCCCGAGAGCCCCTACTGGGTTCTGGAGCGCAAGGGTTGGGATGCGTGCGAGGCCTGCTTGGTCATTCTG
CGTCGTAAGCCAGATGTCCACGAAGAGCTCAAGATTATGCGTGAAGAGGAAACTGCTGATGAGGGAGGTGCTGGTGCTTTCAAGTTCCTTATCGGCCTGT
TCCTGATGCTCGTGACTTCGTTGACGACAGGCTTCTTGAACGCTTTTGTTAGCTACAAGGGTGCCAGCGAGTACACCGACCAAGATAAGCTGTTCGTGAA
CGCCATGGCGTTGCAAGTCTCGGGTGCTGTGATTGCCTTTTTCTTTATTGACAAGCTGGACCACAAGTCGGTCCTGTTTGGAACTCTAATTCCGATCGCG
ATTTGCGCTGGTGTGCTGGGCTTCAACGAGACGTCCGATTTCTTGGGTGACTCTGAGGGTTCTGGCCTGTACGTCAGTCTGGTCGTGATGCTCATGTACT
TCTTCATGGGACTTGGTACGAGCTCTGCTCCTTGGTCAGCTTGCGTCGGCATGTTCACCACCAGTGGCCGCGCCTCGTCAACTACCGTGCTGTTTGCCAT
CTTTTACTTGGCAGACTTGGGCTACGTTTACATGCACACACACGACTCAATGATGGCGAACGAGTACTTCTACCTGTACGGAATCGCAGGTTTCAGTGTC
ATCGCACTGGTCCTGTTATTGGGCGCAGGGACCAAGAAGAACGGTGTCATCTGCACCAAATCGGAAGCCGAGAAGGACCGTGATCGCATTGCTCGCATGC
GTGCCGAGCGCGCAAGTCGCAACACAAGGACTCCGGGTACAGCTCGCCAACGCAACATGAGCCGTGTGCGATCCAAGTCCAATGCAGGCGGCCAACGGGG
CAATGCTACTCCTGGCAACTACCAGATGTACGAAACACCCGCCAATGCCGCGCCGCCGCTCATGCACGCGCGCGCTTAGAGGGAATATTACACGCACAGC
GTGTCTTCAAGGTGTCCATAGCCTCGTTTGTTTTGTACATTCATTTTTGCCTCAATACAGACTTACGTGAAGTTTTAGATTTTTTCTTCTGCTACTTATT
ATGTGCTACGACGTCTCCATAGATCTGGTCTGCAGTCGACTGCAAGGCTAGCAACGTTGCAGCTAGCTCTTTACGTCTTGAGGACGTCTCACTACGACTC
TCGCGTATTAAGATGATGTCGGTCATGTCACCCCTGAAGTCTGCAATGGTTGTTCGAGCAGACACCGGAGTTTCTCCTGATTGAAAATAGCGCTGCGTGA
ACTCGACTTGCTCCCGTTGGCAGTCAATTTTAGCGCCGCTTCTTAATAGCTCTTCCACTACGGCTGGAAGCTGCTCAGCACCTTTGTCACCCTCGTCGTT
TGAGCTAGAATTCGGACAGATTTGACTCGCATCCAAGTCACTGAGTGACTCAGAGAAGCTGTCAACTTGCTCAGACAGGGAAGCATTCGGACATGGCACA
ACACCACTGGGCGATTCTGTTCGACCACTGGATTCAGCTATTTGGTCCGTCAGCGGCAGCAACGATGTCAAATTGGTGACAGGGTGGAAAATTGAGCTCT
TCTCGGTGAAATAGTCCGCTACAACGGCAAATTCAGTCTCGGACGGATGTAGATTGGTCATGCGTTGAGCTTCTAACGCACACATTGGACAGCACGGCAC
AACTGACCATGGTCGACTGCAACCGAGAAACACTCGCTTGTCCTTGGCTTGACACTTAGAGCAGATGGGCATTCCACAGACCCGACAGCTACGAAGACGA
ACCCCGAAGAAACCACTGCCATCGCGCTTCATGCACACGACGCAGACTGCTTTCTTCCTTGGAGGCGGCAGTTGAGCTAAATCCTCTTCAACTTGAACCC
TCGAAGCTGTCCGACGAGCTAACACCGTGAGCTTTTTGGCGTCTGCACAGTCCACGAGCTTACGTAACCCGCCGATAAACGCCGACGTCGTGCATGGAGC
CAACACCTTTGGGAACAGGTTCCCACCCGACATATCAAATACGCCACGCGCCAAGACGTCCACAAAACCCGGTGTAGTCTCGCGGAAGATGCACGTGAAG
AAAACTTTACCCCGAACAACGTTGGTTTTAAATGGGGGACACTCAGTTAAATCCACAGAGTGCAGCACGAGATAGCCGAACTTGTTGCCGCAGCTGTCAA
CCTTGACGCCCATCGCCTGCAGACAGCAAAGATCTCTAGGAGCTCCTATCGACCTGGCAGCGTACAGCCACTTAAGACCGAAGTAGTGCAATGGGTCATT
CATTGTCTCCAGCTCGAGGTTCTGCAGAATAGCAGCGTCCGTCTTCGGCAGCAAGAACGACAACGTTGTACGAGTCTCCTCGTCCGTCGTACCAGCGAAG
CCGTACAGCACGTATTCGATAGTACCAGGGATATTCCCCATTGCAACGACACTCGGTTGTCCATTGGCTACAGCCCCAACAGCTTGAGGGAAGTCTTCCT
CTGCTGCGAGTTCAGCCGTTGCTCGTCCCCGATGACGTCGTCGGAAGAGCTGAAGGCCGTCGAACGATCGAACGGATTTCCAGTCCCGCGGACTCAGACT
TGGTAGACCGTTGGCGAGTCTCTCGTTGCAGCACTTCTCGTCCGACAGAATGGCTTCCAGTCGTTGATGAACCAGATCCCGATACTCTTGAGTCTGCTCC
TCGGATACATTAACATCGGGAAAGTATCCTTTGGGCAGTGGAAACGAGATCTTTGCCTGGTGAATCGAGATCCGAGCATCCGAAAACGACTCCTCCATGG
ACGCCCACGTGCAAATTCGAGACTGTTGCAGGTGAAAAGCTGCCAATACCATCGGAAACGTGGGGACGATAGACGTCGTGGTAGGGAACTGAAGTATCTG
GGTAAGAATGAGCAACAGCACAACGTCGGCATTTCTTTTGCGCCGATGCCCGCAAACTCCCACTCGCGATAATTTCACCGCACGCCATCGCGTTCCTCTA
CATCTTTTCGAAGGCATTGACGGTCTGTTGCCGACGGGGCTGGATAATATCTACTGTTCCTCTTGACTTGTGTCAAATAATGACCCCACGAAAAGCTAGT
GTTGAGTCGTAAAGGAGTTTGTATGCTACAATTCCTCGTCTTGGCCGAAGCCCGCGTCCGTACTGGAAGTCACGGGGCTATAGAAGACGTAATACCCGTC
AGCTTCATCCGAGCTCGCGGTGAAGCGGAATTTCTCCGCATCGTCGTCACTCAGCTCCATGATGCTGTCCTTGGACGAGTCCTCGACGCTGGCCGAGCTC
TCATCGAACGACGAGGTAATCGTCCGGTTAAGGGACGAATTCAGTTCGGCCAGAGTCAACAACGGACCTGGTCGGTGTTTCTTCCAGTCGTCGAACGCGA
TGTTATAGTCCTTAGGGGGTGCTGACCACTCGAAGGGGGAACTAAGTACCGTCGTGTCTTCCTGTTGAGGGTCAGACAGTAGCGAATCCATGAAGTAATC
CGCCACAACGGCGTACTCAGGCACGGCAGGCTGCATCCCTGTCATGTGACCTGCCTCTTGTGCACAACTTGGACAGCAAACACAGGAGGAATGAGGCTTC
TCCTTGCCCAGGAACACGCGTTTCCCTTTGACGCAGCACTTGGAGCAGACGGCGATGCCGCAGATCCGACACCATCGAAGACGGAGACACGAGAGTACAC
CCGTCCCCACGCGCCGGATGCAGACCGAGCACAGTCCGTGCTTCGGAT