Description :
From Genome Similarity Track
Location :
Scaffold_1679:2078- 4018
Sequence
1940 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGAAAAACGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGA
TCCACGATCTAGGCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACTATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCTA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCTCGCCCTACCGACGGGTACATAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTTTGTTAGTCGGTGTCTAGGCGCAGTTGGTAAGTTGGATTCAGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGTCCGGATCTTTTGGTGACTCGGGATTTTAATGTGAGTCCCAAGAAGCTGCTCAAGTGAAGATTGAGCCAGGGA
AAGATGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCTTGCGCCAAGATCCGCTATCAAAACAAGGGAAAGTGAAGGCGAAA
TGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTA
CGCGGAAGAAGATGCAAGCTCCAGAGTCGAAGGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGGTTTTGTATCGCCACCAAGC
TTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATTGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCG
AACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGCGTGTTCGACGCATAGGATATCTTCGAGCTAGACCTGG
ATCGCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATTACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCAAGGATTAG
CCGACCTGCGTCCTCGAACTACGAATCCGCGGCGGAAGACGGCTCCGACACGTCGTCCGATCCCCGACGCATGACTTTAGGACCCTCCGGGGCATCCATG
CTGGAAGCGCGGGCGAGGATCCGAGGACACGAAGTCCCTGTCAACGTGAAGACTCGGGATCCAGTACGCCCTACCCGTAATCTGATACAATCTAGCCAGG
ATTGAGCCCGATCCGGCAAGAAGCCAGTGGAGTTATCGTCAGATCGGGCTCAAGGTAATCGCCGCACAGATCCTGACCGCCAGTGGACCAGACGACCACA
GATTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAGGCTGCGATGAGTCGGTTTCTGGCCGAACAGGGTATGAGAGCGCTGGTGCCACAAG
CGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTAGAGGAAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCA
ATCCCCTTCATCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCTATGACCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGCG
TTCACGGGCAAGGATCAAGACGAAGACCGAGCGCGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTT
TGACTTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGCCCGGATTTGCTGCGCAGCTTCCA
CACCAAGGACTGTGGATTGGGAGTGTCGGTGCCACGACAA