Description :
From Genome Similarity Track
Location :
Scaffold_443:20777- 24485
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_443-fgenesh-gene-0.2Glutamate synthase
Pytap_DAOMBR444maker-pag1_scaffold_443-fgenesh-gene-0.6Adenylate cyclase regulatory protein (Esag8)

Sequence
3708 bases(100 bases per row)
ACCATGCAGCCTGCTATGGTCGTGCGCAAGTCGCTCGCCGCTGTGCGTCCCCACAGCCGTCCTCGTGCGTTGCGATCGCTCTCAACcAGCGCCGCAGCCA
CCAAGAAGGCGGACGACGAGCCGCTCTTCGAGAAGCGCGACGGCTCCAAaGGCAAGATCGTgAGCGAGCGCGCGTTCATTGAGTTCAAGCGAGAGCCTGA
CGCGTACCGCGACCCCGTGGAGCGTCTCCAtGACTGGGGCGAGATCAATACGGCCACGCGCGAGCCATTAGAGCGTAAGGTCCAGGCCGCGCGCTGCATG
GACTGCGGCACGCCGTTCTGCCAGACCAACACGGGCTGCCCCGTGAACAACCTCATCCCCGAGTGGAACGAGCTCGTGTATCGAGACGAGTGGAAGGAGG
CGATCGACCGCCTgCACAAAACCAACAACTTCCCTGAGTTCACCGGCCGAGTCTGTCCGGCGCCGTGTGAGTCGGCGTGTGTGGCTGGCCTCATCGACGA
CCCGATCACCATCAAGAACAACGAGTACGCGATCGTGGACCGTGCGTGGGAAGAAGGATGGATCGTGCCGCGCATCCCACGACGCAATGGACTCCGTGTT
GCCGTCATTGGCTCGGGACCAGCGGGTCTGGCGGCGGCTGACCAGCTCAACCAGAAGGGCTACACGGTGACTGTGTACGAGCGGGAGGACCGCATTGGAG
GTCTGCTCATGTACGGGATCCCCAATATGAAGCTCGAGAAGAAGACAGTCGACcGCCGTGTGAACCTGCTACGAGACgAAGGGATCGAGTTCGTCACGAA
CGCCGAGATCGGCGTCAGCGTTCCTATCGAGAAGTTGCAGAGCGAGAaCGACgCGGTCGTGCTCTGCATTGGTTCTACGGTGCCACGTGACGTGGGcGAC
GTgCCTGGTCGCCACCTAAAGGGCATCCACTACGCcATGGAGTTTTTgaCAAagAACCAAAAGCGTCTGCTATTGACGGTGGATGGTAAGCTCCAGAGCG
GCTGGGACCGGAACTTTGTGACGGCTGAAGGCAAGGACGTCGTGGTTATCGGCGGTGGCGACACTGGCACGGACTGTATTGCCACGGCCATGCGTCATCG
ATGCAAGTCAGTCGTGAACCTTGAGATCAACATGATGCCGCCACCATCCCGTGCACCAAACAACCCATGGCCAGAGTACCCTCGTATCTATGGTGTCGAT
TACGGTCACGCCGAAGTGCGTGCGGTGTTTGATAAGGACCCACGTGAGTACGGCATGCTCACGCGTGGCTTTAAGGGCAACGACAAGGGCGAGGTCACGC
ATGTCATCACACAGAAGGCCATCAAGAACcGCGAatccGGGGAGATCACGGCGATCGAAGGCACGGAAGAGGAGATTCCAGCGGATCTGGTGCTCTTCTC
GATGGGTTTCTCGAACCCAGAGCAGCAGATCGCCGAAAAACTCGGACTGGAAGTCGACCAGCGACGAAACATTCGTGCGGAGTATGGTCAGTACCAGACG
TCGaTGGAAGGGGTGTTCaCGGCTGGAGACTGCCGTCGTGGTCAGTCACTCGTCGTGTGGGCCATCAACGAAGGCCGTGGTGTGGCTGATGCCGTGGAGA
AGTACTTCCTGAACGAAGGCTTCCAGCCAGAAGTCGACCACAACCAGCGCTACGTATAGAGGTAAACCACGACTGTAAtATCCCCcATTCATGCTCTTTT
CGTATGTGCATTCATCCAGTCTATTCTCACTCACCGTCAACTAGTACTTCGAAGTATTTtGCAAACGTCAGATCTTGATGATCGGCACGATGCCACGCAG
CTGCTGCACGCCAACCAGTAGCGTCGGTGCCTTGGCGTCTCGCTCCGCaCCTTCTCGATCATTGCTGTGGTTGTTGTAGCgCAGGTCAaGCACTCGGACT
CCAGTGAGCaTGgAGACATCACGCACCGATCGGCAGTCGCTGAGGTTGAGCACATGCACGCGACTCAGCGCCGAGACGTCGTCCACGTTTTCACAGCCTG
AGAGGTTGAGCGAGTGCAGTCGGCCAAGCGCCGACACGTCTCGCACCTTCTTGCAATGCTTTAGCGTCAGAGTGTGCACGGTGCCAAGTGCCGAGACGTC
TTGAACCATGTGGCAGTAGCTCAGGTCGAGAGTGTGCACGCGCGTGAGGGCCGAGACATCGCGCAGTCGAGCGCATCCCGCGAGCTTGAGCACACGCACG
GCACCAAGCGGAGCGACGTCTTCCAGGGCATCACAGAAGCGCAAGTCAACCTCCCGTGCGTGGGCCAGAGGACTCACGTCCTGGATGAGAGGACAACCCG
AGAGcTTCACACTCCGAGCTCCCACCAGTGAGCTGATGTCCTTGAGTCGCACGCAGCGGTACGCGTTGAGCACTGTCACTCCTGAGAGTCCACCGAGGTC
TTCGATGCCTCGGCAGAAGCTGATATCCAACTCGTAGATGTCGCGCAGCCCCGCGAGAGACTCGATGCCTTGGCATCGACTCAGCACGAGGCGTCGGAGA
CCTCTCAAGTGGCTCACGCTTCTGATGCTCTTGCACGACGCCACGTCCAACTCTTCGAGTCGATTGAATGGCCCAACACCAAGCATCGAGATGTCGGAGA
CCCCCTcACAAGCGCGCATGGTGAGGACACGCACTTGCGTGAGGGCCGACACGTCTCGGATCTGCTTGCACATGGAGATATCGAGTGTATCGACGCACCC
GAGCGCTGAGACATCGAGCACATTgATGCAGCCACTCAAATCCAGCGTGTGGACACCGCCGAGGCCACTGACATCCGTCACACCCAGGCATTTACGCAGG
CTGAGCGTGTGGACTCTGCCCAGGGCACTGACATCAGTCACGTTGATACAGCCAGCGAGaaaCAGTGTTTTCACGTGGCCGAGTTTGCTGACGTCCCGCA
AGTTGATGCATCCGCCGAGATTGAGATCTTCGACATGCGCTAGCGATGCGACATCtCTAACATGGGGGCAGTTGCGCAGACTCACACGACGAACATGACG
CagAGGAGCCACATCACGAACGCCGCGgCAGACGTTCAAGTAGACGGCGTcGCATTGTGCCAGCGGTGTGAGATCGCcAACACCATGGCAATACGACAGG
TCGACGATCTTGGATTCGCTGAGGAACGAGACATCGCTCAGTTGATTGCAGTAGCTCAGGTCAACTtGTTGGACTCCCTTCAAGAACTCGAGATGTTCGA
TCGTCGCGCATCCACTGAGGTCAAGGCATTGTAACCGGTCAATCCACTCAAACAAGCTCACGCGATAGATGCCTGAGAGGTTCAGGCGGTGCACTCGCTT
GTTGGCGATTGCGGCTTGTAGTTGTCTCGGACAGAGGTATCCATTGTCGGTACTCTCCGGCGTCGCATGCGCATCGTGGGTGATGATgACGGGCTCTGGC
TCCGGTTCACCCTCGGGTTCGTCATCAATATGGCTGAATATCGACTCCTCTGACTGGTTCCCTCCGTCGTCCTCAGTATtGACAGCCTTGGGCTCAGGAA
GTGGCTGCAGCGTCACGTTGTCGAGGTTGTGCCAAATCGTCAGGAGCCTTtCCAGGTCGGACACTGAGCACACTAGTCGTGCTTCGCTGCGGATCCTCAC
GCGGCAGTGGACAACGTCGTAAAaGAAtcGGTTGAGCTCTGCCAGCGCGACAGCTTCGTTCAACGTGAGCAAAGGAATCAAGTGTTGATCGTAGAGCTCG
ACAGGGAA