Description :
From Genome Similarity Track
Location :
Scaffold_1727:2077- 6016
Transcript NameFunction/comments
Phyag_g11355reverse transcriptase
Phyag_g11356hypothetical protein

Sequence
3939 bases(100 bases per row)
TAATCGTACAGCAGACCTCCACAGGACAAATTCGACGCTGGTTCCCAGGTAGTCTCGTCATATCCGACCCACTTCACCTCGAACTCACGGACGGATCGTT
CAGTTCCCGTTGACAACGGGGTTCGATCGTTGAGAattgcttcaacttcataTTCACCGGCAAGTTGATCAGGCTCCCAGCTATCTTCCGGAAGCAACTC
CTCGTCGAAGTCTAACCTCGCATCTTCGGTCACGTCTTTCGCCAAACGAGTTCTCGGTCGGTCTCCAAATTCATTCACAGCCTTCAGCCGAGACACATGT
ACTACTGGATAGAACCTGTAGCCACTTTTGTCGGGTAGTTCCAGTTTGTACGCAAACTCTTCTTCCTTTTCCACTATTCGAAAGGGTCCGTGCCACCGGT
GAGCTAATTTCTTCACCAATCCAGGCTTGACTCGTTCCATGTAGAGCCAAACTCGGTCACCTGGCTTGAACAGAGACCTTGGCGTTGTGTTCGTTGACTC
ATCTGTTGGATCTTTGTTCTGCTGTGAAGCACTGTCAGTCCTCGCTCGAGGTATCGCAGCTTGCTCTCGCCTGCTGAGTGCCTCATTGTGCGCCTTCGCA
CGCCGAGCTTTCTCTGCTGCCTGGTATTCCTTGGCCATGGACCATGCGATTTCTTGTTGACGATTGACCTCCCGTCGCCATGCCCACGCTTCAGATTGCT
TTCCGACTCCTCTGCGGAGTGATGTTGACATGGCTCGGAGTGTAGTGAAGGCATCCCATCCATGGACGAGGTAGAACGGAGTCTCTTTCCTCGTCATGTC
GTGGGAGTTGTTGATCGCAAAGACAATTCGTTCTGCAATCTCATCCCAGTCTTGTTGCAAAGGATCCTCGACGTAAGTCTTCACCGATTGCATCACTGTC
TTCACAGACCGCTCTTGCTGTCCGTTAGCCTGTGGACGATAGCTCAGTGTTGCCCTTGACCGACATTGCATCATTTCTGTAAATGTCTGAAAGACGTCGC
TCATAAATCGCGGGTCTCTGTCGTGTCGAACGAGAGATGGCGCTCCAAACCTCTTGTAGACATTCCTTTCAAACGACTGAGCAACCTTCAACGCTGTAGT
GTCCGACATAGCTTCGGCAATAACGAATCCAGTGAACGAATCTTggaacagcaacaaggccGTGTTTCCTTGGCGAGACCTCGGTAGTGGTATCACGAAA
TCCATGGACACGATCTGGAACGGACGTTCAGCCAACACATTACCGGGAGAGTATCCCTTCAAGTGTGGCCGGCTCTTGCTTGTACTGCAGTCTATACAGG
ACTTCACATGCTTCTCAACATCCGCGTAAAGTCCAATCCAGTAGTAATCCAGCTTGACTCTCTGGTAGGTTCTCACAACTCCTTGGTGTCCACCTTCCAG
TGAGTCGTGGCAATTTTGTAGGATTTCCTGAATCATCGTTGTCGGCACTACAAGTCGTAACGTCGTCTCAGCTTGGTTGTCACTGTCTTTCCGACGACTC
GTTCCCAGATAATAGAGAATGTCGTCTTCTGACAAGACGAACTTGTCAGCCATCTTCCAGGCTTCTCGGGATTCTCGGTAGCTCATCTTATTCACATCTC
CACGCAAGAGGGTCTTCAGAGTAGACCACCGCCACTCTTCGTCTTGGGCTTTAGCAATGCGCCgacgtcgttcttcttgcacTTCCACTGGATCAATGTC
TTCAGCGTTGGGTGCAAGTGAGTTCTCAGCTGTTCGTTGTTGGACTTCCGCCAGATTCTCGTTGTCTGCCTCAGTTGGNTCTCAGCTGTTCGTTGTTGGA
CTTCCGCCAGATTCTCGATGTCTGCCTCAGTTGGTGTCATTTGTTCTTCAACGTCTTTTGGAGCGATCTCTTCAGCGAACTGTACGTGCTTCTGCTTAGC
TCTCGCTTGGCGGCGAGTCGTTACAGCTATATCGCCACGCTCTGCCCGTACAAAGTCAACGAACGTCTTCCGTCGTGGTGCTTCGTAGCCATCCAGAATG
TGAGCGAAATTCTCCGGGGTCGAATTTTCGACATTGGCTTCGTCCAATGCAGGCTCATAGATCATCTCTTGGATCCGATTTAGTTCAGCCAATTCGGTCT
TTCGGTGCTCGCTGAGGACCACCTTGGACACCTTAGACTCCAGTGTTTCGCCAGCAAGGGAGTCGGCAGCTGCGTTGTACTCGCGGATTACGTGCAGGTA
TTTTACTGAGTTCAGCTTGGCAACGAGTTCTCGGTGACGGTTCAGTAGTGCCATCAGCGACTCCTTCTTGCACGCGATCACCCCTAGGGATTGCTGGATT
GCGAGTCTCGAGTCACCAACGATAACCAAGTCCTCGGCTCCATGTTCCAGGGCAGCAGTCACCCCATTGTTCATGCCCGAGTACTCCGCCATGTTCACCG
TGGTGTTCTCGAGGTAAGCACTCGCAGCGATCACTATGCGCCATTCAGGTAGCTTCCACACTATCCATGAGCAACTTCCGTAGCCTCCATACTTCTCGGT
CTTCGCTGAACCGTCAAATGAGACAACGAAACCTTCGTAGTCGCGGGGTAATTGTGCGTACAGTAGTTGCGGGTCTAGCCGAGTAGTCGGTGAACCCGTC
TTCGGTGGTGTCACCAGGGTCAACGAGTCATCGAGATCAACGAAGTTAGTTATCGTTGACTGTaagagctgcgtgaagacACAGTCCTTCTCCTTAATCC
GTTGTACCAGTAGGTGCCATGGTGACAGCAACACTGCAAACTGGACCGCACGTCCGAATAGCGATTTAGACTTGCGAAGCCATTCGAGCGTCGAGAATCG
GGTATAGACGTGTAAAGTCTTCCCGGCCAACTGTGAGTAGCACACcttcaatagcagcagcaacgccaacacCTCTTTCTCCGCCGGGTGATAGTTCATT
TCCGTATCCTTCAGTACTCGCCCGCAGAATCGAACAGGGTGCAACTTGTCGTCATGCATCTGCATCAAAGTCGTGCTCAACGCCCACTCGTTGGCAAACA
GCATGATGTGTacgtccttcttgccatcgAAGTGTCGCAAGATGGGAGCATCAgccaccttctgctgcagcgctttgaAACTTTCTTTTGCTGCCGAGAG
GTTGCCCCCGGCTCCAAAATCTTCTTCCTTCAGCTGATACAACACCGCACCGTAGACTGCGAAGTCTTGAATGAAGCGTCTGTAGTAGTTCAGCGCACCC
AGGAACGACTGCATCCCGCGCTTGGTTCTTGGGAACGAGAGCTCGGTGATAGCAGTCATCTTCCTCGGGTCAGCTCGGATACCTTCAGGTGAGACTTCGT
GAGACAGGAAATTCACCTTTGACTGAGCGAACGTGCTCTTCGGGAAGCTCACGCTGATGCGGCATTCTTCGAACCGGCTCAGCAGTCGGTCCAAAGTGTT
CAAACAACCATCGAACGTCTTCGCGCCAAAACAAATGTCATCCACGAAGGAACGCCGTTCAAACACAGGCACCAACGTTGACTGGTCTGCCTCATTCGTC
GCGAACATGTCCGCGTCCGAGCTGTTTACCAACTGCAAGACTGGGTCGCTGTCCACTGTTGATTCACGGTCAGCGTCGAACTTCGTTCGAGCTGTCGGTC
TACTGTCCATCAGCAACTCGGAATCCTCGTTGTTAGACCGGAGGCATTTTGacgcttcttcggctgtcTCCATGCGCTTGGCAAACTGTTTCCAGCCACC
CTTCGGTTGTACAAAGCCCCACAAGGCGTTATCGATCATTCGTTGGTAGATCATCGGAGCATTTTTTAATCCGAAAGGCATTCGAAGCCACTCGAAATGT
CCCAATGCACAAACGAAGGCCGAAATCTTCCGTGCACGTAAAGTCATCATCACAGCCCAGAATCCACTTGCAGCGTCAAGTGAGCAGAACCACAGATAAC
TCTCTAGCTCCGTCAACAGGTCATCGACAAGTGGCATGG