Description :
From Genome Similarity Track
Location :
Scaffold_30:2077- 3351
Sequence
1274 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNAAAGGCTCTAGCGACCAAAAGCATATGGTCGGTCATCTCCAGTCTAAGGCCAAGTCTGGCACGTCCCGCCAAGTTGG
CTTGAGCAAATGTGAGTTTCATTTGCTCATCGTCGAAAACGACGGTGCCTTTATGGCTTCTGGTCTAGTTCGACGAAACATTACCAACCAGGGAGGTCTT
CCTCGACTTCTTCTGGTATTTGCTCATCGTCGATACGACGTGCCTTTATGGCTCTGTCTAGTTCGACGACCATAACACAGGGAGTCTTCCTCGACTCCTC
TGTACTTCGAGATGTCACCCTTCAAGATTTTGGGACGACGCGTGTGTGTCGTCCCGCCCCCATCAGCATTGAATTGCTGCTGTCTCAACAGCTCTGTCTG
TTGAGCACCGATTTCTCTCAACTGCTCGCCCTGTTGAGACCCTTGCTGGTGAAGCAAGGCTACTTTCTCTCTTTCAACGACAAGTTCATTTTGAATGAAC
CTGGATATTGCGGCATGTTGTTGGTCTCTGTCAAGAGACTCCAACATGACGCTAATGACAGTTTCGCCTAGGGTATACGTTCTACCGCACTCCATTCGAT
GTCACTCAAATGTGAAAAGCCTTCACGCGTGGCGTGAAAGCTATCCTCACCCAACATGTTCATGTCAGATGAGGTGGTTGTGGTCGGTGGGCGGACTACA
AAGTGCTACCAGGTGTCACGGAGCACGCCTTTGTGTTGACTGAACACAAGGTTGTGTGCTCCCGACGTCACGTATACGGTGGCTGAGGAAGCGCAGCAAA
GTAAACAGAGCTAGAAAGCTCTGTTTAAAGATAAGGTAGAACTGTATATAATATAGGGGAATGGTTATCCGCACACCTTCTTCATACCGGTAGCCACAAA
TTCTATACCGGTAGACTCAGAACCTCTAAGAAACTACAGAACAGAAGTACATGACACAGGGCACACTGTCGTATTTTAATAGAATGTTTTCTACTCAATT
ATTCATCATTTGTCTGCTTTTCAAGTTTTTCTCTAACAAAAGTATACTTTATGATTTTCTAGCATAGCAAGAAATGCAGACGGAGTCGCCAAGATGCACG
CACTGCTGGCGCGTATCAAGGATGTCGACAACCGACGCGATTTGGAAGAGTTATTGTTTAGGGAGAAGAAGGCTCTTGATGACAAGGTAATGTCATAATC
ATGCCACTTATTGATGAGGTGGGCAACTTATCCAAAACGTAACTAAGACTGCGTTGATAATTGCATGACTTGTA