Description :
From Genome Similarity Track
Location :
Scaffold_233:20768- 22178
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_233-fgenesh-gene-0.3Myosin

Sequence
1410 bases(100 bases per row)
CAACCCCGTGCTCGAGGCGTTCGGCAACGCGCAGACGATCCGCAACAACAACTCGTCGCGCTTCGGCAAGTACATCGTGCTGCAGATGAACCGCGTGGGC
CAGGTCGTGGGTGGCGTCATCGACAACTACCTGCTCGAGCGCTCGCGCATCATCCACCAGGCGGACGGCGAGCGCAACTTCCACGCCTTCTACCAGCTCA
TGGCCGGCGTGAGCGACGAGGACCGCGCGGCGTGGCAGCTGCCGGACTCGCCCGAGGCTTTCGCCTTCCTCAACCACGCCGACAGCAAGATCGACGGCGT
GGACGACGCCGCCGAGTACGCCAACGTGCGCGCCAACATGGCGGCCGTCGGCATCTCGCTCGACGAGCAGCGCGCCATCTACCAGCAGCTCGCGGCGATC
CTGTGGCTCGGCAACGTGCAGTTCACGCAGACGACGGACGAGGCGCACAACCCGATCGCGGCGATCGACCAGCCGGAGGCCCGCGAGGCGCTCGAGCGCT
CTGCGTCGCTGCTGGGCATCGCGACCGAGAAGCTCGAGGCGCTGCTCACGTTCCGCATCGTCAACATCTACCGCGAGGACCAGAAGGTGCTGTTCAACAC
GCGTCAGGCGAAGAAGGTGACGGACTCGATCGCGCGCTCGCTGTACGAGAAGATCTTCAACTGGATCGTCGCGCGCGTCAACAAGTCGGTCGGGTGCGAC
CCGAAGCGCGTGAGCAACTCGATGGGGATCCTCGACATCTACGGCTTCGAGATCTTCGAGGTGAACGCGTTCGAGCAGCTGTGCATCAACTACGTGAACG
AGAAGCTGCAGCAGCTGTTCATCGCGCAGACGCTCGAGCGCGAGCAGGAGGGGTACCGTCGCGAGGGTCTCGGGTGGCAGAACATCTCGTTCTTCAACAA
CCAGGTCGTGTGCGACCTGATCGAGGACCCGAAGACGCACGGCATCTTCCCGCTGCTGGACGAGCAGTGCGCGATCGCGCGTCTGTCGGAGCTCGAGCTG
ATCGAGCGCTACAACGCGTCGCACGGCAAGAACCCGCACTACGTGGCGTCGCGCACGCGTGGCCCGTACTTTGGTATTCTGCACTACGCCGGCAAGGTCG
AGTACGACGTGACGCTGTTCTTCGACGCGAACGTCGACACGTTCTTCAACGACCTGCAGAGCGGCATGGAGGCGTCGACGAACGCGTTCGTGCGGGATGT
GTTTTTGGACACGCGCACGGAGCAGGAGAAGCTGAAGCGTCCGCCGTCGACGTCACAGCAGTTCCGCGCGCAGGTGGCGTCGCTTTTGAGCCAGCTGGAC
GGGTGCAACCCGCACTACATTCGGTGTATCAAGCCGAACACGAAGAAGGCGCCGCTGGTCGTGAACCGCGAGATCGTGAAGGAGCAGGTGCGCTACCTCG
GACTGGTCGA