Description :
From Genome Similarity Track
Location :
Scaffold_527:2076- 6220
Transcript NameFunction/comments
Phymu_g10581hypothetical protein

Sequence
4144 bases(100 bases per row)
GGGACATGTGTGTAACTTCGCCAGCGCGCAAGGAGTGGGCACTGAGCTCGCCCGGATTGCCCCCCGAGGCTTGATGCGGCCTGTCGAATCGACATCGTTA
GTGAGAGCGAAGATACACAGTCCGGCTGACCGTTGCTATTGATAATCACGGCCACTGGAATCTCACGCGGTTGCCCGTGGCGAGTTTTAAGAAAGCAGAT
CGCCTCAACCACGGGTCACAGGAAGCTGTGGCCAGAGCTGTTCAGCATTCGTAGTGTGAGCTTGCCGTACTGGATGGTCTTGTACCCTCTTAACCGAATG
TGGACAGACGTAGCTTCGCTGACTAGGGACGTTGTTGAACCGGACCTGTTGAGAAGCGTGATGTCTTCTGCCTTGAGAACAAACCACGAAAACTTCTGGC
TTTCTGACGCGATTTCTGATCGCCGtaacaggaagaagaacgctaGACACAACACCCCATAGAGCTTGGCCCGAAGGGATCACTTTATTAAGCGGGTGTA
ACAGCGTTCCAGCAACTCGATCGACACTGGTGCCTTGTGTCGCACAGATACGTCGAGGCGATTGACTCCCTTGAAGAGCATGCGAATTTATTCACGAATT
TGTGGATGGTTGCATGGGAATCGAAGGCCTGCAACTTGAAAAAAATGCAGAATACCATGAAGCATGCCTGTGTTGGTAGACCCCGGACAGATCGACCAGA
AGCAAATCCATATTGAAAGCCGTGCACGATGAAGTCGGTAATGAAATGTAGCTGCGCATCTGTCGAATAATTCACTAGCGCAGCCTCGATTCCTTGTCGT
GTTGCCCATGTGAACCAGGCTCGCAAGGCACTTGAGGACTGGCGTGTGTGGGATCCGCGACAGCGCGCGCTCGGAGATAGTGTGCCAGATCCCTTCCAGA
CCCACAACGTCTGCCGAAGGGTTGACCTTTAGCCAACCGTGCGTTAGTTTGTCAAATAGGGTAGTCATAGAACGATGACTGTTAGTACGAGAGCCGGCGT
CTGCGATGCGGTTCTCCTCACCTGCCACGTGCGGTGATGAAAAAATGGATGCCAAACTCCAACTCTCAATACCCGAGGAGCGTTTGGGCTCTGTAGTTAC
GTGGCAATATTTCGTTCTGCCACGAGACGTCTGAGGTGTTATCGATTCGGAATTGTACGTGCACAGGTGCCGGTGTTGATACGTTCTGTACCGCGATGTT
AAACATTTTACGCCACTGAACACCCCATGCGCCTACGGAGAACGCGCACGACAGGAGCTCTTGGTAGTTAATACCAAACCCAGTGGACGGGTTGGATTTC
GATCGGCCGATAAGGGCTCGTTCAGACGCCAAAAATGTGTATCTCAGGACTTGTTTTCGGCTCGAACGAGAGCGCATATACCGGTGTCGGAAGCATCCAT
CTCCACAATGATATCCGGCGGCTGAAGTACCCGAAAATACTGCAGTGGAGGAGCGGTGAGTCTAGAATGATACCACCATTGTAGGTCCTGCTTCATGTCC
TCTGAAACGGGAACGTGTTGCCATCAACGAAGGTGTCGTTCTTGTCTGCGCAAACGTTGGAGAAAAGGTCGCACAGGCCACACACACGCCGCGACATGAC
GAAGCCTACCCAGGAGAGATCGATAGTCGGAGCAACTCAGGCGGCTTGCCGTTAGCGCAGCACGCAAACATTCAGCAGCCTTGTGAATCTTCGAAATCGG
CGTGGCTACGGTACGCTTGATCAAATCGAACATGAGGCCCAAGATCTTTTGATGAGGAGACCAGGCCGTGAATTTTTCTTCATTGATAGCACCGTGACCG
AGTACCGTGATCATGGCTTGACGTAGGGATTGTTCGACATTATTACAGTTAGTTCCAACGTCCGCAGCGACATTGATATGATCATCTACCCAATAGTAGT
TAAACGGACCTGACGCCCGGTATGCATTGGATGTACTTCCCTGCACATGGCAATCGCGCCACCGATGACACCATAATTCGCCGATGAGCCGGACCTGCTG
AAGTGTCGATAACCAGTGCGCTGTCCGGGACATGACGGCCACCAAAACGATACATGCTCTGATTGTGTGTGTACACGTTGCGGAAGGAAGCGCTCACATC
TCTGGCTTGAAGTTGAATCTCAGCGTCAGGAAAGGTATCCTGTTGGGCTATGATTTCGGTAGCAACTGCGTCGCACCACTCAAACGCGGGCGTGCTGATA
CTAATGATGTCGGTCATGTCGTTAACCGAGATCCTCCCGGGGATGACAAGTCGTGTATGACCCAGCCAATAGTGAGTGGGTCAGCATCACCCTTGTCCAC
GACACCGAACGGGCTAATGTGCATTTCGGGCCACAATTCGAGGATATCGAGGTCGAGTACTAGACACCGCCATGTGTCCCGTTCTTTGCGTATGTTCTTG
ATAAGCACCGGATAGGGGTCACTTGCGGACTTGTGGTTATTAGGATACGCTTGTTGACGAGCTACTGGCTTCACTAGCGGTGCTCGGACACCGATCTGGC
GATTTCTACTAGGGCGTCGACATGCTGATAAATTTTGCATGCTTGCCTATGAACAGCGGGCAGCATCCTCTTGTTGAACCGATAGTCTCGTCGGTTTGTC
CACGCATAACTTCGGCGGATTGCGACAGACCGATTCTCGTCCGTCGTACAAATTGTGAAAGCCCATGTTGAAGAGCCTTATAGAGAGAAGGCGGTCCCCT
ACAGCATTGAGGAGATGGTTCGAGCAGCGAGGGCCCTACGACTACCAACGCTGCATTGGTATTCCGCAGCCTCATGTCATCCCACATttctgcacgtgct
gctgcgttaGATGCAAGAGCCGCCGTGTAATTTCCCCGCGCAACTGTGCTCCGAATTGGCTGCGGAACCCTGGCGTATAGCTGTGGCTGTTGTAGAAACT
GTCGACTCGAGGCGGAGTTAACCAGAATATGGACTAAATTTAGCCGCCCATAGTGTAGATTGATATGAGATAGAAACATCCAGTCTATATGGGTGCCTTG
GGACAACCTTATATTTAATGAAGTGCCATGAGGCGACTCGAAATTGAAGGACCACGGGGTGCCTGTGTGCACGTGCGTTCATTTGCAATACTGAGCTCGA
GTGTATTGAAGTAGGTACTGCCTGTGAACCGAAGTACCGACGAACCGGCAGAGCCTCAGACACCTCACGGTCGATAGTGGCGGCTAGCCTGACGGCGCTC
CTGGCCGTAGTTGCGGTCCAAAAATTCCTGAAGGTCGCAAGGAAGCCGACCATCCCAGTGGTGCGTGCGGCGTTGATAGGCGCAACGCTTCGTGCTACCA
CCGTAACACATTCCACCCGCAAGGAAACGGAGGCACGGCTCCCTCCCCTCTACATCACGGGGAATCTGTCTCCGATTGTGCTCCGGCATAATAGGAGTCC
TTAATGCCGGTCCTTGACGAGGCAGTCCCGACGTATTCCGGTCAGATGATTTGGGTTGGCTACCGGTGGTTGCAGAGGCTATTCGCAGTGCGAGGCCATT
TAGCGCCGCCTGCCGGTCAGGTCTGTGGTAATCCACCGAGCGGTTGGCCTCGCTGTAGTCCCGCCGCCAGCAAGGCGAATTCACTAGGAGACATGCCAAC
GCACTACCGAGAAATTAATTCACGTACAGTAATGCGAGCCGAACACGCTCGGGCGAGTTGGCGTCACGCTCCATATTCGCCAGAACAACCGCTTCAAGTG
CGGGAGTAGTCGCCGTGCATGATCACACCACAGGGCGTCACCCACCGAAATCAGTGCACCCACAGCTGCAAGTAAGTCGTTATAGCGGGAGCATTTGACT
TCGGTGGTCGGCAGTGTAGCTCTAGCGCCGAAATCCTCTGCAAAATTTGTGTTTGTCGAACCCCGCTGCAACTGTTCTAGCTCGGACTGGGGTCGGAAAT
GCATCACCGTAAACCCGCGGGAGCTGAGGCGGCCGCTATAAAGTGCCATTAaaactgctggaggtgcgTCAAAACGCACTCAATCCTGCTCTCAAACATG
CAGCACAAAAGACGTGGGAGATAACCATATACCTTGATCGGAATTCAGGCCACGGAACTTCCTGTGCGCGGAGAGCTAGTGCGACTGTGGAGGGGTAATA
TTCCTGGGTTACCCAGTGGGGGTAGCGTCCACATGATGCCGGGA