Description :
From Genome Similarity Track
Location :
contig_4:207573- 209625
Transcript NameFunction/comments
g1095.t1hypothetical protein
g1096.t1rna-binding protein 8a-like

Sequence
2052 bases(100 bases per row)
TGGCAGCAATTGATTCGAATGGCATCGGCATGCAGCCTATTCGCGACAACAACATGATGTGGGCTCTATTCTTCGTGCTCTTCATCATGGTTGGCAGCTT
CTTCGTCGTCAACCTTTTTGTGGGCGTTATCATCGACAACTTTAATCGCATGAAAGCTGCCTTGGGTGGAGACTTTATGCTGACACCAGAACAGAAGAAG
TGGATCGAAGCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGACCTCCTAGAGAGAAATTCCGGCGCATCCTGTTTTATCTCGTCAAGA
TGCAGCGCTTCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGCTGCAAGCCTACGCCAT
TAATATTATAAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGAAGACCAGTGGAACCAA
TTCGACTTTTTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATGCTGGTGCGTGTTTTTC
GAGTCACACGTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTCTCAGCAATATCACATC
CATCCTGTTTTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAGTCACGCCAACTTCCAG
GATTTTGGTAATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCTTGGAACAGCTGCATGCATGACCTAGCGTCGAGTACAGCAGGCTGCGTGG
ATGACCCGCCCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCGCCTACGCTTTCTTCTG
CACCTTCACATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGACGAAGAACCGTTGTTT
GAGCCAGAGATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATGCTGCTGCTCGTGAACC
TGCTTAGACCACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCCGTGGCAACCATCTCGT
CCTCCTTTCTAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTGCTGCTTGCCATGACCC
GGGAAATGGTCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGGCACCATCTCCGATATG
CCAGCTGATCAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCGCGCCGCATCCAGCGCC
AAGTGGCTCAGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCGGCCGCCCCAGAAAGCA
GCGCGACGCACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGGACAAAAGTCTCGTTTT
CGCTGAATTACCGTCGACTGACACGGCGGCCTCCACGTCGGTCCGCGTCCTTACGGAAGGCCCAATCCACCTGGATCGTACTGCCCAGGATTTCCTGGCC
GTCCATGCGCTCCATGGCCGCCTTGGCGTCCTCGAAGCTCTCAAACTTGACAAGCGCGTAGCCCTTGACGAAGCCTGAGCGGCGGTCCAAGTTCAGGTGC
AGGTCCTTCACCTGCGCGTCCTCCGCGAAGGCGTCCATGACGTCCTCCTCCT