Description :
From Genome Similarity Track
Location :
contig_4:207557- 210631
Transcript NameFunction/comments
g1095.t1hypothetical protein
g1096.t1rna-binding protein 8a-like
g1097.t1hypothetical protein PPTG_06415

Sequence
3074 bases(100 bases per row)
TGGGCAGATGTAATGATGGCAGCAATTGATTCGAATGGCATCGGCATGCAGCCTATTCGCGACAACAACATGATGTGGGCTCTATTCTTCGTGCTCTTCA
TCATGGTTGGCAGCTTCTTCGTCGTCAACCTTTTTGTGGGCGTTATCATCGACAACTTTAATCGCATGAAAGCTGCCTTGGGTGGAGACTTTATGCTGAC
ACCAGAACAGAAGAAGTGGATCGAAGCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGACCTCCTAGAGAGAAATTCCGGCGCATCCTG
TTTTATCTCGTCAAGATGCAGCGCTTCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGC
TGCAAGCCTACGCCATTAATATTATAAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGA
AGACCAGTGGAACCAATTCGACTTTTTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATG
CTGGTGCGTGTTTTTCGAGTCACACGTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTC
TCAGCAATATCACATCCATCCTGTTTTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAG
TCACGCCAACTTCCAGGATTTTGGTAATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCTTGGAACAGCTGCATGCATGACCTAGCGTCGAGT
ACAGCAGGCTGCGTGGATGACCCGCCCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCG
CCTACGCTTTCTTCTGCACCTTCACATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGA
CGAAGAACCGTTGTTTGAGCCAGAGATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATG
CTGCTGCTCGTGAACCTGCTTAGACCACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCC
GTGGCAACCATCTCGTCCTCCTTTCTAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTG
CTGCTTGCCATGACCCGGGAAATGGTCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGG
CACCATCTCCGATATGCCAGCTGATCAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCG
CGCCGCATCCAGCGCCAAGTGGCTCAGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCG
GCCGCCCCAGAAAGCAGCGCGACGCACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGG
ACAAAAGTCTCGTTTTCGCTGAATTACCGTCGACTGACACGGCGGCCTCCACGTCGGTCCGCGTCCTTACGGAAGGCCCAATCCACCTGGATCGTACTGC
CCAGGATTTCCTGGCCGTCCATGCGCTCCATGGCCGCCTTGGCGTCCTCGAAGCTCTCAAACTTGACAAGCGCGTAGCCCTTGACGAAGCCTGAGCGGCG
GTCCAAGTTCAGGTGCAGGTCCTTCACCTGCGCGTCCTCCGCGAAGGCGTCCATGACGTCCTCCTCCTGCGCCTCTTCGTGCACGCCCGTGACGAAGAGC
AGCCAGCCTTCCACGGACTGCAGCGCTGTCGAGTGGTCCCTGGGTGACGCCTGGAGCTTCTCGAACACGCCGCTCTCGGCCGGGTAGCGGTTCGAGTCCA
TCGCCGCGGATCCGGCGCCGCGTCCCTTTACCACGCGCGGCTTGTCCTCCTCTTCCTCCACGGCCATGGCCGTGTCGCTCTCGTAGTCCACCTCGTCCGC
CATGGTAGTTGGATTGTGGTTGGAGCTTATTGGCGCTGCTCTTGTTAAGTACGATATTGGATAGATACATGTAGCCATGTTGAGAGATTTTGAGACGGAT
ACATGCAGCCATGATGAAAGGCAACTTGTGTCGCTAGTTAAATACTTCCGAGGAAGCGGGGGAGCTGACGCATGGATACGTGGTGGCTGCAGGGAGTTCA
GACGTTTCTCGAGGAGCGGAAGCGGTGTAAGGAACGCTGCAGCGGCTCGCCGTCGTGCAGGGCCTCGAGGATCTTGTTGTCCTGGTCCTCGATGATTTCC
GCCTTGGTCGCGATGTCTTCTGCACGCTCGGCCGGGATCACGAGCACGCCGTTGATGTCTCCGCGGATGATGTCGTTCTGGCGCACCACGCAGCCAGCCA
CCACCACGGGGCAGTTCACGTCGGCGATGGTCGTTGAGCCGTACTCGCCGTGCACTGACGTCCCCGTTGCAAACGCCGGGAAATGTTCATCGTGCAGAGC
TCCTGCACGTCTCGCACGCACCCGTCCGTGACGACACCGGCCACACTTCGCGTCTTGGACGCCGTAGCGAGCAGTCCACCAAACACAGCCGACCTGACCC
CCGTCGGGGCGCTGATTACCACCACCTGCCCCATCTCGGCCGTGTCCATGTAGTCGTACGAGCCGTCGCCGTTCATCGCGCCCGTGATCGGCATCATCTT
GACCGTGAGCGCCGGTCCGCAGATGTTCATGGCCAACGGGGCGTCATACCCGCGCACGAGGTTCACATCCAGCA