Description :
From Genome Similarity Track
Location :
Scaffold_25:20753- 21857
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_25-fgenesh-gene-0.326S proteasome non-ATPase regulatory subunit 7

Sequence
1104 bases(100 bases per row)
CTCCCGGAGGAGGTGGTGACCCACCCGCTGGTGCTGCTGAGCATCGTGGACCACTACAACCGCGTGGCCAAGGACACGAGCAAGCGCGTGGTGGGCGTGC
TGCTCGGCTCGACCTTCCACGGCAAGTGCGACATCACCAACTCGTTCGCCGTGCCCTTCGACGAGGACCTGCGCAACCCAGGGATCTGGTACCTGGACCA
CGACTTCCTCGAGAGCATGTACCAGATGTTCAAGAAGATCAACGGTACGTGGGCTGGTTGCTCGCTGGTGTGTTTAACGGACTGCTTGACTCACTCGCGA
CTGCCCCAACCCAGCCAAGGAGCGCATCGTGGGCTTTTACAGCTCCGGTCCCAAGATCCGCAAGGCCGACTTGGACATTGACGCGCTGTTCCGTCGCTAC
TGCCCGAACCCGGTGCTCGTGATCTGCGATGTTCGCCCGAACGTCGAGGGTCTTCCCACGACTGCCTATGGCTCGATCGAGGAGGTTGAGGAGGTGCGGA
AGAGGCAATATCTATCGACGCTCGGACTCGACTGGCGGCTAACTGTTGAATGTTGCGACATACAGGACGGCAAGGCCATCAAGCGCACGTTCAAGCACAT
CAAGTCGACGGTTGGAGCGTACGAGGCCGAGGAGGTCGGCGTCGAGCACCTGCTGCGCGACATCAACGACCCGTCCGTGAGCTCGCTGGCCGGCCAGGTG
AAGCACAAGATGACGGCGCTCAGCGGTCTGCGGGAGCGCCTGGAGGAGATGAAGACGTACCTGGAGAACGTGGTGGAGGGTCGTCTGCCGCCGAACCACC
AGATCATCTACAACATGCAGACCATCTTCAACCTGCTCCCGAACCTCAACATCGACGCGCTCGTGCGCTCCATGTTCGTGAAGACGAATGACATGCACTT
TGTGAGTGGCTGGTCTCCTAGGGAAGAACAGGCGAATCGACGGGGCGACTGACGCATTTGATTGTGATGTGTGAACTAATCAGGTCATCTATTTATCTTC
GCTGATCCGGTGCACCATTGCGCTGCACAACCTCGTGAACAACAAGATCAAGTACCGGGAGCTCGAAGAGCTGGGCTTCGGCGACAAGAAGGAGGAGAAG
AAGG