Description :
From Genome Similarity Track
Location :
Scaffold_46:207515- 211309
Transcript NameFunction/comments
Physo_136508hypothetical protein
Physo_136509PREDICTED: similar to CG9854-PA, isoform A

Sequence
3794 bases(100 bases per row)
CCGACCGTCTAGTGGCAATAATAAATAAACAATATGACTTAATAAAATAATTTATGGACGGCATATTGGCCCTTCTCATCTTCTGGTTCGTACGCTCCGA
CGCTGTGCGCATTATTCTTGGTGGCCATGTATTGCTTCAGCTTGTCCAGGTCCACGGGCGCGCGGTCGTTGGCCGCCCTACACATACAATACGCGGCACA
ATCAGCATTTCATCCGTCCTCATTGCAGCGTATCAACCGCGGTGGCGGACGCACTTGGTGCGGGGCATGAGCGCCTCGATGTCGTCGTCCATCTTCGCTC
CGCAATTGTGCCGCCAACTGTCTGTACCGGCCAAAAGAGAGGATTTTCAACATTCAAATTCAACCTCATTGGTCGAAAACCATCGCGTCTTTTTCCACCA
GTGGTATCGCCTTACGCATTCTTTTTTCCGCCAATGGAATCTAGAAGCTTTATCGACCAATCCCCGACTCGGAGACAGCGCCAGCCTCGACTGCCAAGCA
GATTGGCGCTGTCGCAAGCAGGACGGAAACCAACGCGGCTAGAGCTTCAGAGCTCCAGAGCTTCAGCAGAGGCAGAGCTAGCTCCACGACAGACGCGAGC
ACGACACAGCAACGGCTGCACTAGCTAGTTAGCACTCCATTACTGGATTCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCTCGCTGCCAGCCCAC
ATGCAGAGCTCGACGTTCACCGTGGCGCCGCACGTGCTGGAGCAGGCGTACAAGGCCATCCGCACGACGCCGCCCGAGCCCAAGGACCTGGAGCAGTCGG
CCAAGCTGCAGAGCTTCATGGACGAGCACTTCCCCACCGAGTCGGACGCCAACATCACGCGCCGCTCGCTGATCCTGGCCGAGCTGCGCTCCATCTTCCG
CCAGTGGGTCAAGCAGGTGTGCATGGACAAGGGCGTGCCCGAGGAGATGGCGGCCGACGCCGGCGGCCAGATCCTCGTCTCGGGATCGTACCGACTCGGA
GTGAACGAACCGGGTGCGGATATCGACACCATCTGCGTGGCGCCGCGCCACGTGACGCGCGAGGACTTTTTCTCGTCGCTCAAGGAGATCTTCCTGCAGC
ACCCCAAGGTGTCGAACCTCGTGGCCATTGAGGGCGCCATCGTGCCCATCCTGACGTTCGACTACGAGGAGATCAACATCGATCTGCAGATCGCCATCCT
GCCGCGCAACTCCATCCCGGAGAACCTCAACATCCTGGACGACCACGTGCTGGTCGGCGTGGACCCGGCCACGGAGAAGAGTCTCAACGGCCCGCGCGTG
ACCGAGCTCATGATCAAGCTCACGCCCAACCGAGAGAGCTTCATCAGCGTGCTGCGGATTGTCCGACGCTGGGCCAAGCGCAGAGGACTCTACTCGAACA
AGATGGGATACCTCGGCGGTGTCAACTGGTGCATCTTGGTGTGCTTCATCAATCAGCTGTACCCGACTGCGGCGCCATCGACGCTTCTGCTGAGGTTCTT
CATGGTTCTCAACAACTGGAAGTGGCCGCTCGCCATCCAGCTCTGCAAAACCCACGACGCGAACTTGGGACTCGAGGTCTGGAACGCCAACGCGGGTCAC
AACCGGTAAGTTTAAGACTCTTTTATTTATTATTTTTGCAATTTTTTATTAATGAATTCATGAAATTGTCCTTGTAGGTACCAAGTGATGCCGATCCTGA
CGCCGGCGTACCCGTCGATGAATTCCTCGTTCAACGTCTCGACGCACAGTTTGACGGTGATGAAGGAGGAGTTCAAGCGTGGCTTGACCATTGTGCAGGA
TGTGCTCAGCAAGGGCGGCTCGGAGTGGGGACCTCTGTTTGAACCTTCGGACTTTTTCGCCGTCCACCAACACTACCTCGCAGTCGAGGTGTACACGGAG
AAGCAAGAGGAGGAGGCGGCCTGGTGCGGCTTCTGTGAGTCGCGTATGCGTAAACTGGTGGAGTCTCTGGCGTATAACCCGGCACTCTGCCGCCTTCGTG
CCTACACGAAAAAGTTCCCGCTGAGTTTCGTGACGGGAGGCGAGGCTCCTGCTGGTGAGCAGCCGAATGGCGCAGCGCTGGCGCAGCCTAGCAAGTTTGG
TGTGTGCTTTTACGTGGGCTTCGACATTGATCGCCGCCAGCTGCGTAGCCGTGAAGTGAGCATCGACAACTCTGTGGAGTACTTCAAGAACAACGATCTG
TACCGCTGGAACAAGCGAACTCCGACCATGGACGTGCGTGTGACCCCGGTCGTGTGGAAAGCGCTGCCTGAAAGTGTGTTCGAGGATATGGGTGGCCGTG
CTGTCGCTCGCGTGGCTCGTCGTGAATTCATGAAGAAGAAGAAGGAAGACGAAAAGAAAGCCGAGGAAGCTGCGGCACCGAGCCCTTCGCCTTCGGGCGA
TGAGGGTACACACTCTCAAGAAGACGGTGACGAGTTGAGCTGCAGTCAAAAGGCAGCATCGCTGGCAAACGACATGGCCAACGGTAAGGGCAGCATCTCA
CAGCCTGGAAGCCCTGACCCCGCAGCTGACGGTGCCGAGGTGACGAACGGCACTGAGTCGGTCAACAATACTCCGGTCAAGCCGAAGAAGGTGGTGTCTT
CGGGGTCACCAGAAATGACAGGTAAGCGTGATCGCGATGGAAAAGCACTGGCGGGAGCTGGCAGTCCGGACGTGAAACCGTTGGGTGCTGCTCTCAATTC
CGCCAGTACGTCGACGAATGGTGCGGCGACTCGAGGGATGGCTTCACCTCCCGTGAAGGTGGTGAAGAAGCCCCTGGAGATGGCAGCGGCTCCCCCTGCC
GTGTCGTCGCCGCGCAAGAGACGTAAAATGAAAATCACTTTTGCCAAACTGAATTGAGGAGGTTGTGCCCAGGGCAATGGTGGGCGTGGGTGATGGCAAA
AAAGGAAAAAAAACAAAAGAAAAGAGGAACACCGTGGCTTGCCATGGAGAAAAAAAGAGAAAATGGTTCCCCACAAAAAAGAGGTAGCAGTAGCAGCAGC
AGAAGCAGCGAGGACGCCTTCGGACAACCAGGTCGAAGCTTGCAGGGAGGAGGATGGTGAGTGCAAGCAGATTTTGAGCAGCGAGCGGGCCTCTTGTCCG
TATGTTGCTTCCAGGCTCGCGGACGACAGCGACGAAGCCGACACCAGACGAAGACACTGCAAGCGGTGACCGCCCCAGGAGTGATATTTCTTGTTGGTGC
GGGGTGAATAGATAGGAAAAACACACTTGCGGGCAGGTCAACAGGATTGCAGCCGACTTCACGCGCATCCAGACCAAGCCTGCAAGACAATAAAAACTAA
ATAACACTAGCAAAATCACAAAACATTGTTCCAGCATTCACCTTGCATTCATCCTACCAACACCTCGACAGGGTAACTTAGTTGGAAAACAGGAAGAACG
ACACCAACTTCAGCCAAAAAGTCTTCTCAGCTTCCGTGAGTTCTTCTTGCTCCAGAAATGCTAACAACTCGAATCGGGGCGGCGACGATGATGTGGGCAT
TAATTGGGGTTGTGAACAAACGGCCAGCACTCGTTGGAACTTGGTCTTCCAATCTTTGTCGGCAGATTTTGGGTGTTCTCGATCCGGCACCGAAGACACG
GAAGGGCCAGCAAAATACCTCACCAACACACTCACAAAGAACGTATCTGCCACTGACTCAGACTTGTGCAGCGAGGACGAAGCTTCCACTAACAGTTGAA
CTCGAGCAGAAGCCAGCGAGGTGATATCCAACGAAGTTCGATGCCACAGGGCACCCAGAGCTTCCTCCGTCTGGTTTGACAGCCACACGCCAAA