Description :
From Genome Similarity Track
Location :
scaffold_10:2075- 4548
Transcript NameFunction/comments
Pl_112534hypothetical protein PHYSODRAFT_532690

Sequence
2473 bases(100 bases per row)
CGCGGCATGCTGCCGGCGCTCACAACCAAACCCAAGCAGGCGGTGCGTCAGGTCAAAGGTCTGACGAATGACTCCATCGACTCGTACTCGAACACACCTC
TTGGTGGTGGCTCAGGCATTGGTGGGATGGCAACGACGTTTGTGGATAACACCGAGTCAGGCAGCGCAACAGCGCGAATGTCCCCACCAGTGACTGGTAG
AGCGACTATTAACTCTTCACGTACAAAACTTGCAACTGGGGAGGAAGGAGTGACAATGGCTCGTGTAGTACGAGATCGCAAAGCTTCCGGAGAGGAAGAG
TTGTCATTACGCATAGGAGATATCGTGAAAGTCCTATCCTCGAAGCGCACGGGCTATCTCAAATGCGAAGCTGGTGATGAAGTGGGTTATGTGCCTTCGT
CGTACTTGGAGTTTCTTGACAACGCTACAGAGACAGAGAATGGGACAAGCAATAGCAATGGTAATGTTACTACTGAAGAAGCTCAACGCGCAGCCGAAAA
GCAGCGTAAGAAGCAGAAGAAGGAGAAACGCAAGAAGGAGAAGCGAGAAGTGAACGACGCAAGTGAACCCGAAGAAGCGGCTCCTGTGGCTCCTGTTACT
GCACGCTCGCCTCGTAAAGAAGCTGCTAACGCTGACAATGAAGGCAACGAGTCACCTCGCAGGAGGAAGAAGAAAGAGCGAAAGCATCGTGATCGAGAAG
CTGGTGAAGATACACAAAGAGGTGGAGCTGCTGCTGCTGAAGAACCTCTAAGTGCCAGGGCTCGACCTGCGCCTGACGACACAGAACGATCTCGTACTAA
AAGCAAACACTCAAAGAAAAAGCGTCATCATGTAGATAGCAGTGACTCAAGTGAAAGCGATGGAGGGCGAACACGCAGTGGTCGTCACGGACATCGTCGC
CGTCATCGACGTGGATCAATTGATAGTGATTCCGTCTCAACATCTTCTGACGATTCGAGTGGAAGCTACCGACGGAGACGTCATCGGCGTCGCCACAGAC
ATCGACGAAGTTCTAGTGAAGATGATGATGACGAGGATAGTGACTACAAACGGCGGTCTAGACGTAGCAAGAAGCGCCGTGACAAAGACGATGATGACTC
CGACCCTGAAGAAGGTTCTCGCTCAGCTCGGAAGGCTGAGAAGAAGAAAGTGGCAGCAACCTTACAAGCAGTGGAAAAAGGAGTGAGTCAACTTGATGTC
AAGGCTGAGGAAAAAGCACCCGAAGCAAAAACTACTAATTTGTCGAGTAAGAAAGAAGAACCCGACAGAGACCGTGACAGAGGAAAAGAGACTGAACGTA
GTGAGGGATCGTCGGAAGGACGGACGGCCAACGTGTCTTCAAGTCGCAAAGATGACGAAGGTCGTACTAGCACCAACGCTTCTTCCGTGAGTAAGCACAA
TAGTAGCAAGGCTGGTCTTGGTAGGCAAATTGGCGAGAAGATGCGATCATTCTTGGGTGGTAGCAAGAAGAACCACAGTAGCAAGAGTTCCAGTGGCATC
TTGAACGCGTGCCCTGGAACTGTCCAAGGCGAGGAAGGTTGGTACGAACACGGTGAGAACGAACGCTACTACTTCGTGCTAGTAGATGGTAAATGGAGTC
TTCTGTACGGACCCATGACTGAGGATGACTTCGAAACCTTTTCCAACCGAGTACGTGCCTTCATCGTTCTAATACTACCACAGACACTGACATTTTGTTT
TGCTCCACGTCTAGGTGTTGGAGCAAAATCGTGCCATCGAGCTTCCACCAACATATCTGCACAAGTCCGGCTACTTTCTCAACCGCGAGCTACGTGTTCA
GAAGGAGCAATAGAACCGTGAGCGAACTATCATTACCAGCTCTGACATCTATTGAATATATATTGAAAACGATACGATTCTTTAGAGGCGTACTCACAGT
TTCCAAAACAACTTCCATTGGAAGATCTGGTCGAATGGATTCCTCTCAAGGACTTAAGCTTACAACCCATTTTGTCGATGACCGTGACAACTTCCAGTTC
CTCATTCGAAGATAGCTGCTGTCGCGAAAATGCACGTAAAGCTGCAACCTTGGATGGACACTTAATGTATCCGCCTTGCATTAGTGAGCAAGCCTCCAAT
AAACCTGTACTCGCTGCAACTGTGCCTTGATTAGCTTCCAATATGAGTTTTTCATGTGCCGAAAGCTATTGTATCAGACATTTCGACGGGGATAACTCCT
CCATTAGATATTATCCACAAATTGGTATTGCAACATTGTCTGCTTCCGTATCTGTAGATTGGGATGGCGCTTTGCAAGACGCACTTCGTTCCGTTTAACT
TGCGGTCCACAAATGTTGCGATTCAGGAGGTCAATACTCTGTGAGTAGATGCGACTACCTTGCCTTCTCTCAACTCATCAGAGCCTGCCTTGCCTTTCGT
GTGTATTTTTCTAGCAGTACTGGTGTTCGGGTGATAGTGAAATGTCCTCCCAGTCCACCTTGGCAAATCGCGT