Description :
From Genome Similarity Track
Location :
Scaffold_329:20745- 21787
Transcript NameFunction/comments
Phyke_g8448hypothetical protein PHYSODRAFT_345031
Phyke_g8449hypothetical protein

Sequence
1042 bases(100 bases per row)
CTCAccttgatctgcttgaaCGAAAGCAGCAACGTCGCGCAGGATGTGACCGtggccaccgccagcacgaTCACATACGTCACCGTCCAGTCGTAGTGTG
TCGAGTCATCCATTCACGAATAGGAGGTGGGCCGCCACAAAGGACAAATTTGTTGAGGCAACAGGCCGTGCGTCTCCCCTCTAGAACAGCGCTCGAAGAC
AGACAATCGACACCTCGACACCCAGTGGCAGGTGACACACAATTCgctcttggtgctggccCAATCACGGAATAACGGAGACTggtgcctgctgctgcac
catcgtcaATTCAACTCATCGATGGCAGGGTGAGTTGCGCAGCCAGATGGTGCGGGTCGGGGTCGAAGTGTTGCCTGCTCGCTCGGACTGTTCATCATCA
ACTCGACACCGGGTTGCTTGAGGCGGCACCGAGAAAACAGAAAATGGCAAATCCTCGTCGCGTTGCAAGCAGCCACGTCTCTGCAATGCAGGCAAGGAAA
AGGGGAAGTGCAGCGTTGCGGGTGCACTTCGGAGTCCAAAGTTTGGAGTGCTGTGCCTTGGCAGACAAGCGCACTGCAGCGCAACCACGCAGAACCTGCG
GTAGATATCTGCGTGATTGTCTGGTGAACTGCCATGGTGCATTTGTCACTTACAAGTTGATTGGTCACGACTCGAGATGCGGTTTTTGAAGTTTGCCAGA
TGTTTGAGAGCAATGCCTGCGAATAAATTCTTGCATGGCTTCATCCCCGAACCTACCCATGGCTTCATCCTCGAACCAACCCATGGCTTCAGCTCGAGCC
AAGGCGCAGACACTGCTTCAGAATGGTTGCATTGCGATGGTCCTTCTTTAGCCACTCAAGTCTGGTGGCTGCACCTTGTAGAGTTCTCGCTCGTCGCCGC
AATTCGTTCTGTATGGCGTCCAAAACTTTTTGCCAGTTCGTTCCGTAATGCTGAGGGCTTACTTGAGTTGCATTCCTCGCCTTGACTTGACCTCGCTTCG
CTTGGACCATAAGCTGGAAAGCGTACAGGCCAATTGCCCAAA