Description :
From Genome Similarity Track
Location :
Scaffold_632:2074- 3969
Transcript NameFunction/comments
g4893.t1hypothetical protein

Sequence
1895 bases(100 bases per row)
CGTGGATGGCCTCTACTGGCTCCAGACGCCTCAGCGATCGGCGAATGCGGCGACCAGTGGGAAGACGATCGACCTGCACGCGCGTATGGGTCACGCTCCG
GTGGAAGTGCTTCGCAAGATGGTCGACAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGAACAAGCGTGTGTCGCGGCTGTCAGCAAG
GGAAAATGGTCCAGAAGCCGTTCCCAAGCAACCGTGACAAGCGTCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCATGGAAGAAGA
ATCACTGGGTGGCAGCAAGTATCTGCTGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGTGAAGACTGC
ATCAAGACGTACGTCACGAAGGTGCAGACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTCGCGACCAACTCGCTCAAGT
CCTTCTACGAAGTCGAAGGCATCGAGCAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCCATCCGGACCTTCGTCACGAT
CGGCCGCAGCATGCTGCATCACGCCAAGTTGGACACGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTGCCGTCACCCAAG
GTGGAGCACAAGACTCCATTCGAGATTGTGTACAAGTCCAAGCCAAGTGTCAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGG
AAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGGTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCA
GGTGGTTGTCAGTCGCGATGTCAACTTCGATGAGTCGGCCTTTGGACTTCGGCGCATACTTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTTGACG
CGCTGGACCTGGACGACAACGATGGACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAGCCGACCGAGTGGCGACGACGACACTGCCAGAAG
ATCGCGCCCCGTTCGCCACCGAGCTGGCTTAGAAGAAGCAAGTGCGCCGGGCGTATCCTCCTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGG
GACCAAGATGAAGACGACGACTCGACGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCC
AAGAGGCGGTGAACGGCCCGGATCAAGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTT
GCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAAATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAG
GGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCG
GCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGG
TGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGC
TTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGACGGTCACTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTAC