Description :
From Genome Similarity Track
Location :
Scaffold_32:207327- 211297
Transcript NameFunction/comments
g6893.t1XP_009528137.1 hypothetical protein PHYSODRAFT_545408 [Phytophthora sojae
g6894.t1hypothetical protein

Sequence
3970 bases(100 bases per row)
ATGCAGTCCGCCGTGCGCCAGCGCCTGGCCTCTTCCTCCTCCGCAGCGTCCCGCGCGACGTCGCAGCTGCGCCGCGCCGCGTCCTCCACGGCCGCCGAGC
CCGTGTTCGCCAAACGCGACGGCTCCAAGGGCGAGATCAACAGTGCGCGCGCCTTCATCGAGTTCAAGCGCGAGGCAGACCCGTACCGCGACGTGAACGA
GCGCGTGCACGACTGGAACGAGATCAACTCGGGCCGTCGCGACCCCACGGAGCGCAAGATCCAGGCCGCGCGCTGCATGGACTGCGGCACGCCCTTCTGC
CAGACCAACACGGGCTGCCCCGTGAACAACCTCATCCCCGAGTGGAACGAGCTCGTGTACCGCGACGAGTGGAAGGAGGCCATCGACCGCCTGCACAAGA
CCAACAACTTCCCCGAGTTCACGGGCCGCGTGTGCCCCGCGCCCTGCGAGTCCGCGTGCGTCGCCGGTCTAGTGGATGACCCCATCACCATCAAGAACAC
CGAGTACGCCATCGTGGACCGCGCCTTTGAGGAGGGATGGATCGTGCCCCGCATCCCGCGCCGTAACGGCCTCCGTGTGGCCGTTGTGGGCTCGGGCCCC
GCAGGTCTCGCGGCCGCGGACCAACTCAACCAGAAGGGCTACCAGGTGACGGTCTACGAGCGCGAGGACCACGTTGGCGGCCTGCTCATGTACGGCATCC
CCAACATGAAGCTGGAGAAGAAAACGGTGACCCGTCGCGTGGATCTTCTGCGCGAGGAAGGCATCGAGTTCGTCACGAACGCCGAGATCGGTGTCTCACT
GCCCGTGGAGAAGCTGCAGGCTGAAAATGACGCCGTCGTCCTGGCGCTGGGCTCGACCGTCCCGCGCGACGTGGACATCCCCGGCCGCGACCTCAAGGGC
GTCCACTTCGCCATGGAATTCCTCACCAAGAACCAAAAGCGGCTACTGCTGACGGTGGACGGCAAGCTGCAGAGCGGCTGGGACCGTAACTTCGTCACGG
CCGAGGGCAAGGACGTCGTGGTCATTGGCGGCGGCGACACGGGCACGGACTGCATTGCTACGTCCATGCGTCACCGCTGCAAGTCGGTGGTGAACCTGGA
GCACAACCCGGAGCCTCCCGTCCAGCGCGCCCCGCAAAACCCCTGGCCGGAGTACCCGCGTATCTACGGTGTCGACTACGGCCACGCTGAGGTGCGCTCC
GTGTTTGGCGACGACCCGCGTAAGTACAGCCGCGTCACGAAGGCGTTCAAGGGCAACAAGGACAACGAGATCACCCACGTGGTGACGATCCTGGGCGATA
AGGACCCGGAGACCAACGAGATCACGGAGATCCCAGGCACGGAGGAGGAGATTCCGTGCGACCTGGTGCTGTTCGCCATGGGCTTTGTGCACCCGGAGCA
GAAGATCGCGGAGGATCTTGACCTGGAGGTGGACCAGCGCCGCAACATCCGCGCTGCATACGGCAACTACCAGACGTCAGTGGAGGGCGTGTTTGCCGCT
GGTGACTGTCGGCGCGGCCAGTCGCTGGTGGTGTGGGCCATCAACGAGGGCCGCGGCGTCGCGGACGCTGTGGAGAAGTACTTCCTGCAGGAGGGTTTCC
AGCCGGAGGTGTCCCAGAACCAGCGCTTCGGTTAAATTCATCCTCAGAAGACAGTATGTACCGGTAGACAATCGCATCAACAACTCACATCGATGCCTTC
AAGTGGAAGGCGTCGCCTGCAGCCGACGACACGGCGGTAAAGTCGTAGCTGGAAGGGAATCAGCAGAGAACAGCGCGGCGATATGAGCAGCGAGCAGAGC
GATGTAAAGATGAGGGATAATTATTGTAATAGCAGAGAGGTGAATCCGCTGGAAACGAGTTGCATCTGCTGTTTGATGCATCCGTCTCAAGACCAGCCAA
GTGGTCGAGGAATCCGCGTCGAGACCGTCAATGCGCAAACGGAGGACATCAAATGAGCGTGGATATGAATGGAGCATCTACGTGTTACATCTCGGCTTTA
CTGGATGAGAGCTCTACATGCGGATGATGGGCACTCGGCCGCGCAGTTTCGCGACCCCGTCTTTCAGGACCTCGTCGTTCACCCGGTTGTAGCGCAGGTC
CAGCACCCGGACGCCAGTAAGCATGCTCACATCCGTCACCTTGCAGCAGTCCGAGAGATTGAGTTGGTGCACGTTTCGCAGAGCCGACACGTCCTCAAGC
TGCACGCAGCCGGAGAGGTTGAGCGTGTGCACGTTGGCCAACGCAGTGACGTCGCGGACGTTCGGGCAGTGGCGCAGTGACAGCGTGTGAACCGTTTCTA
AGGCCGAGACGTCCTCGATGCGGGGACAGTAGCTGAGATCGAGTTCGCGGGCGTGTGCAAGCGGTGACACGTCCACGAGCTTGGAGCATCCAGCGAGCTT
GACGATCCGAGCACTTTGGGCCAGCGGACGCACATCTTGGAGGGCGTCACAGAACCGCAAGTCGACGTCTTGCGCTCCGGCGAGGAAGCTGATGTCGCTG
ATGGCACTGCACCCGGACAGGTTCACCTTTGTCAGGCACTCGGCAGACTTCGCCAGCACTTTGATGTCCTCGAGCTTTTCGCAACGGTAGGCCCCAATGC
TGTGCACTTGGCGCAGTGACGACCCGAGCGAACGCAGGTTCTTGCAGAAGCTCACGTCGAGCTCGCGTACGCGAGTGAGGCCATCGAGTTCTGTCAGTTG
GGTGCATCGTGACAGCACAAGGCGGTCAAGTGCAGGCAGATGTTGCAGCTCGGAGCTTGTAAATCCCGTGCAGCCCGAGAGCTCGAGCTCGCGTAGACTG
CAACTTGCTCTCAGCGCCGAGAGGTCCGTTACCGCGTCGCATTGCCGAAGCGAAAGCTCCTGTACACCACTGCCCAGCGCGGAAATGTCGCTCACGTGTC
TGCAGAGCGCAAGCTGGAGCTTGGACACGCGTCCTAGTGCGCTCACATCCGTGACGTTGATGCACCCTGTGAGGTCCAAGTCCTGTACACCGCCGAGTGC
CGAGACGTCGACGATGCCCGAGCACTTGCGCAGTTTGAGAGTGTGAACTGTGCCGAGGCCGCTGACGTCGGTCACGTTGATGCAGCCGGAGAGGTTCAAC
TCGTGGACATTGCCCAATGTGCTGACGTTCCTCACATTCGCGCAGCCACCCAGATTCAGCTCGTACACGTTGCCGAGTGCACTCACGTCACTTACGTCGG
GACAATTACGCAGACTTAGACGGTGCACATGACTCAGCGGGCTCACATCGCTGACACCGCGACACACGTTGAGATGCACCGACTCGCACTTTGCCAGCGG
TGTGAGGTCTGTAACAGTGTGGCAATAGGACAAGTCCACGTGCTGAGAATGACTCAGGAACGAAACGTCCTCAAGAAAACTGCAGTAGCTCAGGTCCACC
TCGCGAATGCCGGACAACCAGTGCAATCCGTCGATCTGGCTGCAGCCGCTCAGTCCAAGCTCCCGCAAGCGATTCACCCCATCGAATAAATTCACGCGCA
CGATTCCTGACAAGTTCAACCGCCTCACTTGGCTGTTGTCGCCGACTTGGATGCAATCTCGAAGCACTTTGGGGCAGCTATACCGCATCGGAATGCTCAC
GCCGTCTTCGTCGGTGTAGCTCTCGTTCGACACTTGAGCTGGTTCAGGCTCTGGGGCGGGTTGGTTGTCCTGGTGGTCGACGATGAGGCCACCAGCAGCG
TTCACGTTGTAGTGAATGCTTTCGTGTATCTCCGGGCCATCGCCGACAGGTTGAAAAGCCACGTTGCGCAGGTTGTGCCATTTCCTCAACACTCGGAGCA
GCTCTGGAATGGTGCACACCAGCGAGGCCTCGGCTTGAATCTGAATCTGTTTGTGCACGATGTCGTAGAAGAATCGATTGAGCTCTGCCAACGCCACCGC
TTCGTCCAACGAGAGGAATGGGATCAAGTGCCCATCCCAGAGCTCCACGGGCATCGTGTGCTGGAGGTGA