Description :
From Genome Similarity Track
Location :
contig_59:207311- 209540
Transcript NameFunction/comments
g9008.t1hypothetical protein

Sequence
2229 bases(100 bases per row)
CCGCTCGCGCTCTCCGCTCTTCCGGAGCACTGGGGCATTCCCAAACGTGCTCCCTGGCTTCCACGTCGGCCTGGCAAGATGTCTCAGAGGAAGACACCTC
GCGACGCGAAAGCGTCGAGGACTAAGCCCGCGAGGGCGAAGTCTTAAATCGGCCAAGCCTCGCGGCAACGCCTCCGCGTTGGGGGAAGCCGTTGATGCGG
CTTCCCAGGCGATTAATTCGCCTGGCGACGCGTCCGTATCCGCGTCCGCGAAACACGCGCTCGCGACGTCGTGGTTCGCCCGATGTACCACCGGACGACC
GTCCAAACCCTCGGTTTGTACATCGGGACCGAGTCCCGGGTCGCCGAGCGACCTTGAGCACTGCTCCTCTCCTGGAGCAGTCTCACACGACGAAGGTGAC
GCGCCAAGTCACAAAGGCGCGTCTGAGGACGTGTCCTCGGTCCATGGGGACCTGAGGAGATGGGGACAACGTGCCAAGTCTCCTGCGGACACTGTCCACG
AATGACAGCGCCGCGGGTGGCCAGAAGGACGGCGACGCTAAGGCAGCGTCGCCAGCCAAGCGCTTGACGCTCGGCGAGGGTCTCCAGCGAGCCCGTGACG
CCAAGGCCAAAGAGGCCGGTCGAAGAAGCGAATCGCTTCTCGGTCCCCTCCCAAGGGCCGGACTAGGGGGCTTGATGTTATCAAGTCCCTGTTTGACTCC
TCGGAGTCGAACTCGGAGGATGAAGAGGGACAGGTACATGTCCCGGAGGAGGTCGCTAATGCGCTCGACGAGCAGCAAGAACGCCTCCAGGAGGCCCGGA
TGCGCCAGTGCCTCCCCCCGACGCAGCCAACTCCTGGCGGGGGTGCTTCGGGAGAGAGGGAGTCCAAGTACCCCAGGGGCTACTTCCCGCCCGATGAGAA
CACGGGTTCTCCGTTGTTCTTGAGAGGCTCGGCGCCCCTCGTGGCCTCCCGAGGCGCGTATGAGCGCGACTTGATCCAAAAGGTGGACTTGTTCACCGAG
GATATTGAGGCCGCTCGGTGTGTGGCGAAGCGGGATCACGAAAATTGCTGTCGCGATCCCAGACTTACCAGCGGTACGCCCGGACTGCCGACTGTCGGAG
GGGGTACTCCGTTGATCTGGCGTGATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCG
GTGGTTACCAAGACGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGTGGCAACGGCCACGTGGGTATTCTTCACGCGGTCGTCGGTGGTCTGCC
GATCGGGGCCTGGTTGGGCTTGATCGGCGTGGGTGGGGGGGGGGGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGAGTTAAGTGG
TTGCGCACCTGGCCAAGCGATTCAGGGGCTCCCGTGTAATTACCGTGCGCGACGAGGTGAGTCCGGAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTG
GAATCAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTCAAATTAAGCAAAACAAACAAACAAAGATCTCAGCTTCCTATCCTTCCTCCCCT
TACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCGCGGATCCTTACTCCGGAATGATTGCGGGTGTACCACCAAAATGGTACGCCACGATCGTCATT
TGTGATCGGGATCGCGATCGCAGTTGGGACCACGATCGCATACCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCTCTG
TACCCATCGGGTCTCCATACCCCTACCCCTCAGGTCCAATCTAATCCCTCCAAAGTCGGTCCTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATC
CTAGCCCATCGTTGGTCCATCACGAAATTTCCCAACATCCACTTCACCACAATTGCCCCTGTACACGCCGTGGCTGCACAACAGTACACTCGTCACTTCT
CCTTCTCGCTCCTCGCCACCACACCTCCACATCACCATATCAGGCAACTCCTCGCCGGATCAGAGAGATTCCACGAGCGATCCTTTCCTCATTCGCCCAC
GTCAGCTTCCTCTCGATCTCCTTCGTCGCAGCAGAGGGCTACGACCTCGGACCCGTCCGCCGCAGTTCCTGTAACCTCGGATGCCACCGTAACAACTCCC
TCGGCTTTCTCCGGACATGTACAACGAAT