Description :
From Genome Similarity Track
Location :
Scaffold_40:20730- 52555
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_40-snap-gene-0.22Sulfotransferase
Pytul_var.sporangiiferummaker-pug3_contig_40-snap-gene-0.24Transmembrane protein
Pytul_var.sporangiiferummaker-pug3_contig_40-snap-gene-0.23Gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_40-abinit-gene-0.40APG7 autophagy 7
Pytul_var.sporangiiferummaker-pug3_contig_40-snap-gene-0.17Cathepsin B, cysteine protease family C01A
Pytul_var.sporangiiferummaker-pug3_contig_40-snap-gene-0.26Transmembrane protein

Sequence
31825 bases(100 bases per row)
ACCGCTCTCTCTCTTTCTCTATGTGCGTCACGCCACTACTCACCACTTAAAGCGGCGGCCAAGCAGCTCAAAGAGCTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCGCGCAACCGCTGCTCCATGGCTGCGTCCATGGACTCGTACTTACGGGTGTTCTTGCGCTCCGTGTCCGCGACCTGGTGAGCC
GGTAGCTCCAAGAACTCGTACGCACGGTTCACCTCCTGCTGTGTGCCCTCGGCGGTCTTCATGTCGTCCAAGTCGATCACGAGCACCTGGTCCCGCGGGA
ACACGCGCAGCCAGAGTCCGAGTTGCAGCGCGTACAGCCCTCGGCCAACGTACGAGTGCGCTCCGTGCTGCTGAGAAAGCGCATTGGCGTACGTCTGGAA
CCGATCGAGCGCTGCGTTGGCCTCGTTCTCGCCGCTCACAAGTGAGTCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGGTC
GTCGTCAATGATCTGCTCAAACGACTTGCCCTTGACGGCTTGACGCATGCGCAGTTGCGCGGCCGTGCCGTTCGGATCCGCAGTCATCTGGTAATGCGAG
AACGCGCGCTTTGTTGGATCGCGTAGCATCACGATGAGCTTCATGTCCGGGTACAGCTACATCGCATAACGAAATCGCCACAACGGACGGACCACAAAGC
CATTAGTCGAACGATATGAGACTCTCTATAGACCAAGATCAAATAAAATAGTCCACACGCACCAGTTTCAAGCGCTTGGCCACGGGCTCGCCGTACAGCA
AGTAGCTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGCGTTCACACT
GGAGTGACAAAAGGTACTTGATTCTGTCCACAAACACACACACATATAGGGTCATAGCAACGTCAGAAAGGTAGACAAGCGGACTCAAAGTGACACCACG
AACCTCAAATCGTCGAGCGAGTTGCCGTGTAGAGCGATGTCAACAGGGAGATCCTGATCAGAGCCCCCAGAGGAGAACGACTGGAGCACGGGCTCGTACT
TNNNNNNNNNNTGCTTGAACGCGGCGTCCCACGCCCAGTCGAAGAAATGCGGTTCGCGACGCTGCCCTTTCATCGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCGGGTGCTGACTCAGGTATTCGTAGAGCGACGTCGTGCCGCACTTTTGCGCGCCGATGATGACCCAGTTCGGCGCAAACACCTTCTTGATGCGTGCT
TGCGCGAGCTCATCGCCCATGCGCACGTCCACGAGCGTAAACATCTCCATCAGCTTCTTCCACACCAACTCGCGGAAGCCCGCGTCAACCTTGCCACCAG
CCAGCACTTTGGACTCTATGGCCTTCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTGAGCGCTGCGGCCGCGTCAGCA
TTCCTCTGGTCCTTCACGATGCTCTCGATCTCGATGAGCATTCGTCCAGCTTGCTTCTTGGCCTGCTCTTCGGCGCGCGCGTCGACCTTGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTGCGGTTCTGGATCACGTGCGTCGCGTCCACGTAGTCGAAGATGAGGT
GGATGCGGTGGTGCGCCGTCGGATTGTGTACGCTGTGCTTGGCCGCGTTGTTGAGCTCAACGATCGTGCCTTCGTTGAACGCGTAGCGCGTCATCGACGC
CTCGAGCGCCCCACTGCAGAACGCAACCTGACATTTGCATTTATAATGCATCATATGCATGCAAACAGCTTCATGTTCAGTGTTTACTTGTAAAAAAAGG
ACGCAATCGCATTGCTCTTCTCACCTCTGGGAACGTGACAATCGGGACGTGAATGCGGTGGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTC
TTCACACCAGCAGCACATATGCACACACAATGAATGATGCATACACACGCACATATATAATAACACAATAGCTAGCCATCTGCTCACCCGTTGTCATGAT
GCGCTGGGATAAGTGTGTCGCCCGGCATGCGCGCAAACAGACAGCGCACGACCTACATACACATCCACAGTCCATAAGCACCATACCAAAGATAAACTAC
TTGTATACAACAACAGCAAATGCGCACAGCCTTCACAATCATTATTACCTGCTCGGGACGCACGCCCATGACCTTGAAGATCTGCTCCAGGTACTCGCGG
TACTCGTCGTAACGCGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAAACACGTTTTCCAGCTGCGTGTCGGAGAAG
ACGCACATGATGTTGTCGACGCCCAGTTTGTCGTGGAACGGGCGCTGGAAATACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGCAGGTGCGTG
CGCAGCGTCGAGACGTCGTACTCGCCCACGAGCGCCGCGTACAACAGGTGCGCGTGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATGGGATGGATG
ATCGATAGAGTCACAGACACAGTCAGAGGGGGCGGACGGAGTGGCGCTGCAATTGGGCTAATGGAGCTCTTGGCCGAGAGCACACGCGCACATTTTTGAT
GCACATGAACAAGGCGCGTGTCTGGGGAAAACAGCATTCACCCAATAACCCATGTGAAACGGATGGGTGGATAATTTGTCACTCAATTGTTGTATCTCAA
TAATGGATTATTGGGTGCAATGGAAACAATAATATCTGCTTTCGTAGTTGCTTTTTATACAATCAATCAATTGTGCATTTTGAGAGGCAAACAAAGTTTA
CTGCTTGGATGATGATGGCGGCGTCGAGGGCGTGCGAAGTCGGCTCTGCTTGTTGGATCCGCTGCTGCCTCCTCCCCTTCCTCTTCCTCCTTTTGCCAAG
TTCTTTTTGAGCGCTTGCTCGAGACTCGTGTTCTTGGCTATGGACGCGTTCTTTTCAGATGTACGCGGTCGAGCGTGTGACATGACCACTTCGCCTGCGT
CAGCAACGGAAGACTGAGAAGGCGGCATTGCTGCAGTTGGTGATCCAGCAGCGACTTCATCTTTCGGTTGCGCCAACTCGGCTTCTTCGGTGGATCCACT
TCGAGGTGACTTGGGTTTGCTCTTCTTCTGGAGAATGCTGTCCAGGATCTTGCTCTTCCCACTGCTCGGTGCCTGCTTGTTGAGCAGCATGTACGTGCCA
AAAGGTTTGGGCTCGTCTTCTTTTTGCATGGCTGTGCCGCCAGTCTCACTTTCGTTGTCTTCGTCTTCACCTTCATGGTCGTCAGCAACTTTATGACCAT
CTTCTTGTGTTTTCGCTTCGTCGACTGCACTCTGGTCGACTGTCAATTTTGTTTCCGCAAGAGAATCGTGCTCGATGAGCTCTGTTCGGCCAAACTGAGC
AGCCGGCTCGCCTGTTTTCACTTCTACGCCGAGAGCAGCCACCACAAGTTCTCTTGTTTCTTCACTTCGTGCCTCATTTTGTCCAATGCCCGCAGTTCTA
TGCAACGGTGGCGGCGATGGCAAATCACCTGATCGTGCAGCTGAGACGTCCGTTGTGGTTTCACGATTGCTCATTGGCTCCTTTGCTTCTTCAGCGGGGG
CGTGATCTGCTGATAAACTCGTACTGCTATCAACCACAAGAGGTACTGTAGCCTGTAATGCATTATCTTCGACTGACAGTTGCAGTGCCTCTGTTCGCTC
ACGCTCTTGTGTTATCGCCTGGTATGTGAAAGATTTTGGACGTGCATCTTCCAAAGGAGCTACTTGGCTCTTCTCAGCCACACTTTCCGTTGCCTTGAAG
TTGTTCGTCGTCTCTTCGACTTCCTCTTCTTCTTCAACGGTGGCAATACGCGAGTCTAAGAGAAGAGTAGATTCTGTAGGTGAGGGTTTGCGTGGAGACG
GTGCTTTCCAGTTTTGAAACATTGTTTTCGCTCGTTGCGTTGGCGACGGAGCTTTCTTCGAAGGCGACTTTGTCACGATACCACCACCTGCTGCGTCGTC
ACGTGCTTTGCCCTTTTCTTCGCGCGATTTCTTCTTTAGTCCCATCTCCAAAGCTCGTTTCTTTGGAGACAACTTGCGGTTCTGCAAAATGACGTACGTC
CCCGTTGGTGGCGCTTCTTCGACACCGTCCATGCCGCTACCGCCGTCGCGAACAAATCGGTTCTTATGTTCCGTCGACGCTTTGTCTTCGACGCCATTAT
CCGAGGTCGCTGGCGCTGACTTTGGAATCAACGATTTCGAGGAACCCCGTGACAAAAGTGGCGGCAATTTCCCCACTTTGCTCATGAGTTTGTAGCTTAG
CGAGTCGCGTTTTTCCTTCAACTCGCGCAATAGATTTTGTCGCTTGACGAGGATTTTGGATTGCGGATCCGCACGTGGACCAAAACGAGTAGACGAGCTC
ACAAATTCTTCTTTCAGGAGGGCTTTCGCTTTCTCTCTATCGATGGCTTTCGCGGCCGCCAACGACTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
ACCGCATTCTGCTCTTCTTGGTGGTACTTGCGGACACAGTGCATGCCGTAGAGGAAATGTTCGAAATCCACGAGATCAGCGTAGGCGGGATCTAGATCAT
TCAAGAACTGGAATACCAGTTCCGGCGCAACATGCACACCCAGCTGATAAATCGACTGCGAGATCACAGTGTACGGCACAAGTCCCATCTTCGCGGCATC
GGCGTCCTGGAACAACAGGTGGAACGCCGTGATTTCCTCTTCCGTGAAACACTCGATTGCACGTTTCACTGTCGCACGACGCTGCTCTGCGAGTGTGCGA
TGCGCATCCTGGCGACGGTCTCTTACCACCTGCAGATACCGCCGGCGTGTGATCCGCGTTGCCAGGAGTCTCTGGATGCGAACGGCAGCGTTGAAGCGTA
TCCGCTCGTAGAGACTCAGCGAAGCGTAGTGGCGTGCAGCAGCTGTAGCCGCATCAGGTTGGATCCGCAACGCCTCGCGACCGTAGCGCACGAGGCGAAC
CACCCAGGTCGTTTGCCACCATGCACCAAGCGTTGACCACAGGATGCGCACAAAGATCACTGTTGGTTCAATGATCACGAAATGGAAGCCCATTCCGACG
CACCAGCACAGAATACACTGCCACGCTGTGGCTTTACCCAGGCTCATGGAACTGTTGATGATCAGATACGTCATGACCGCGATCCAAGCACCGCAGATCG
CAAAAATAACATACACGATCGATGCTGGGTACGGCACGCTCGCGATGTCTTCTTGATGGCCCAGAGACGTCTGCAATCGGCTCAGCGAAGTCAGGGACTT
CCTTCGCTGTGGAGGAAGTACGGTCTCGGGCGGGGCGTGAGAACTCGCCATCTTGGACGCACTGGATACGACTGCAGATGCCAATCCTCTTCGCTCTTGC
GGCGGTGCTATCAGTGACGCATTCGAAAGTTCCGTGGCGATTGTCGGCGTGACGCTATTGAGACTGGATGAGAGCATTTGGGACAAGATCTTGCCGCGAG
CCGGCGCTGCGATCTTCAACCCGACGACCTTCTCAAATGTGAGGCGCACGTCGGACTTGCGCTCCTTGTTGCCCTCATTGACGCGCAATTTGAGCTTGGC
GTCTTTGGAGATCACGATATCGTACGCGAGGAACACACTGCTGGCTAGTAAAACAAACTGTGCAAGGCAAATGCCGATCGCAAAGTAGCTGATCGTATCG
GCGAGGTCGTGGAATGCCCTCAGCATTTTACCGAGACAGCCGCCAAACTCAACAAGCTCCTCTTGCGTTTTCATGATCGCACTGCCGTTCACACTCAGCG
CTTCGTATTCCACCTGCACGAATGTTCCTGTTGGACATGGTCGAAACGCAGCATCCGACGCGCTACGGAAGCCGCAGCACTGGAGTTCCTGTTGCACACG
GTTTCGGAAAAACGCCGAGGTGTCCGATTTCCAAGCACGCTCAAGGTGTTGGACGACACTAAAGCCTGTCTTCCGAATCGTCCAATTCGATATCGTGTCG
GTTGACTCTTCTAGCACTTGATGCACCATGTAGACACCGACGAGAATGCATGCCATAAGCAACAGCGACGCGATCGCAGTGATGATAAACACAACGTGGC
TTCCACTCCGTTTCTGGTTCCTCATATCGACGGCGAGCCATGCGACTAAGGATGTGAGTGCGACGAAAAGCGACACAATTAGAAGTTCTTTCGGTCCTTG
GTCGATTTCAACCCCGTAGAGACTATCGTGGAATCCAATGAGTACGAGCCCCATGAGCGTCCCAATGCCACATGCAAGAAGGAAGAGGCTGATAGCGACG
ATGTGGTATACGCGGTACACAAACTTGGTCAGCCACGTGTACCAGCGCTCCTCCGTCGTGGCATGCAAGGTATCCATCGTCGAGGATGGTGGACCAGAAC
CACTCGGGACCGCGTTTGCTACTGCTGGCGATAAGTTTGCCAGGTTGCTAAGTTGCAGTGGCCGCCGGCGCTGGAAAAACAGACTTCGGAATAGCAACAC
TTTCTCCTTCCTTTGCCGCGCACTTGCGACCTCACTCGTCTCGGCATCACAGCGATGGCGTACAAGCTCGAACAGGAACCGACAAGCGCATTGCGCAGCA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCCGAGCACAGCCCAAACATTAGGCTGCTCGCAGGTCTTCAGCGACTTGCGGTGGC
AGCCTTGGGTTGTAAAGTAGACCGTGTAGATGGCCAGTGTCGTCAGCATGGCGCACAAAATGCTTACGATCCGCTGGGAACGCGTAAACTTTGCATCGTA
CAGGTGACCTAAGGAGAATGCGAGGTGATGTTTGCGCGCTTCGCTCTTGTATTTGCCAGCCACGTAGCGCACGCGGCTCTCGATCGCAAACCACTCTTCT
TGCTTGAACTGTTTGAGCTGCTTGAGCAGCACGACTCCGAGTGCTAACAGCACGGTCTCAGTGGTGGCGAGGCCCACAAAGTACTCAAAGAGCCATGCGA
AGGAGGAGCTGATTTGCTCTACGAGTACGTGGTCACAACCGCGCGGACTGGATAGTGGGCATGTGTAGCCCATGGCCGGACGATCAAAGACTATGCCTTT
GCCCTTCACGATGACTGGATCGTGGAACCCACAGCAGGCATAGTCCAACGAGATCACATGCTGGGTGTATGGGGACAGTGTGTTCCACTTGTGATCCAGG
AACGAGTTCAATTGCGACTGCCAGCCGACATTGGCAGAAAACTTGGAGAGATACGCAGTGAGGGCGACTGCGACCCACATCGACAGTGCGAAAACCGCGC
GTCCGATTGACTGGAAGAAGAGCGGATGCACGGCGTTTTGACTCGCAGCGTAGAGCGAATACAGATTCACGCCGAGGCCGCACACGGCGTACACCAGCAG
TGCGATCCCGATTGAAAATGCAAATAAGAGCTGCAACAGACTCGAACTGAAGATCGACCATCGCGAAATCAGGTCGAGACTCATAAACAACGTCGTGAGT
GACGCAACCATCGAGCCGAACGCGAAAACCAGCAGTCCGATCCTTGAAAATACCATCTTCCACGTTTGACGCCATGGTGTTTTCCGGCCTTGACGCACAA
AAAGCACGCTGGCAGAACCCAGCACTGTGACAAGAAACACCAACATCGAAACACAGAGCTTGAATGCGTAGTCAGCGACGTGGACTAGGTAGGTTGTCAT
AACAGCCGAACACCCAGTGTCCGCCGCTTCAGGGCACAATGGCTGCGTTTTCACTTGGGGTCGCGTTTCTGTGAGCTCTCTCCGCGACGTGACTGCCTGC
GTTTCCCCACTCGACTCAGACAGGCGTCTCGATCGGGAGTATGTGTCAACGCTTGTGGCTTCATGCACCTGCATCCAGTACGGCGTCTCGGCCATGTCTG
TATAGGCAACAGTTCCATTTGATGCCTTGACTTTAGCATATCCGCAGCACGTAAATGCATTTTGGATATACATTTTCGTCGTTGCAGGCGCTGCTTTCCA
TGCTTCTTCCAAGTGGAATGCCGTCGCATCTGACGACGTGTACGATGTTGCGTGATGCGAAAACCGGAACGAAAGACCGAGAGCACCGAAAATCGCGACA
AAGAGAGCCAATCCCGCAACTCCATAGATGAAGAACAACCTTCTCGATCGCTTCCACGCGAGCCCAAAACCTGCAACAGCAAACACAACGAGACCGCTTC
CGAGTACGACCAAGTACACTCCGAGCTGTTTATCGAACACTGACTGCAGCAAGTACGCCAGGTGCAGCACGTTGAGCTGATAGACGACGTCGATGCCCGC
CCATGCAAGGACCATTCCGAGTACACCAGCGACAAAATTGAGCAGCACAACCACGAAAAAGCACGCATTGTGCACAAACACGTCCCACGAGGTCTGATAT
TCATCTACTTCCGCGTGGACGATGGGCTGCTTGTCAATAGGGTTGATCGACGCCTTGGTCGCGAATCGCCGTAGTCGAACCAACAAGATGGTCGACAACA
CAAACACAACCGCCTCTACGAGCACAAAAGCCGTTACTCTCGTCGTTAGCACGGCGATGTTACTCCCCAGAATCTGCTCGACAGTCGCACGGCAAGTGCG
TATTGTTGGTTCATTGGTTCCTGTATCGCTGCCACTGAGGAGGCATGTCCCCTCTGAGGTTGCATCGAAGCCACAACACTCCATTGCGACCTCAAGATTC
ACGAGCGTTTGGCGCGGCAAAGCGAGGAATCTTGCCTCTGTTGTTTGCATGATCGCGGGATCGAGCAGCAAATTGCGTTGTATGCTGGCCAGGAATTGCG
AAATTCCAACAGATATGATCAGAAATCCCAGAGAGAACACCACAAACCGCTGTAGTCCTCGGATGTCTCGATAGGCTACTGCGTGAATCCCGCGCGCCAA
GATCAGGAAATAGATGCCAGCGGCCACGATCAGCGCCACGCCAACCTCCATGCCGTACAATGCTGCTGTCAATACGTTCGAGATGTAATTCGCCTGGAGC
ACCATATCAAGCCCGCATAAGATAGCAAACACCAGTGCGCACGCCAGCACGTAATATAGTGACGGCAGAGTGCACAGCAAAATAACGTTGACTTGAGAGT
GCAGCATGGAGCGCTTTGCGGAGGTCTCCCCGGTTGCAGAAGACGCAGGCTCGCCAGCGAGCTCCAATAGACNNNNNNNNNNNNNNNNNNNNNNNTGGCG
CCACTTCACCAACATGTTGGCAATCGTAATACAAAGCACCTGGACAAGCAGGAGTACTTCAATGTACGCAAACGAATGCGCGAAAAACTCTTGTGCCTCA
ATCGCGAGCACGTGGGAGCACGTTCGTGGTGGAAATACATCGAGAGCTTCTTCTGGGCACGCACTCGGCTCTTTGACAGACACAAACCCACAGCAGCCGT
AGTATATTTCGATCTCTTCCTTTGTGCTATCAGCGAGTGAGTTCCATACCCGGCTGAGCCCTGATCGTAATGCGCTCGGCATCGTCTTGAAGTCGTCCAG
GTATCTATACGCAATCGCGGTAAACACCGCCTGGGCAATCAACAACAGCAGTACCAATGACATATACGTGTGCCGAGAGAGATGAGAAGCCCGCTTGCGC
GATACGATCAGCCCGAAGAGGCCAGCAACGACAATCGCTCCACCGAAAACAGCGACCACGAGGCCCAGAACATTGCCATACACGTAAAGAAGCAATTCTG
AGGTACTGTTCCCGAGCACGAGATAAAAGTCGACCCCAACGAACGCGAGAATCACTCCGAGGATGACTAAAAGCGCATTGCAAAACCTGAAAACCCCAAG
CACGCGTAGATATTGGGTTTCTAATTTCTTGGTGGCTTCAAACAGTGTTGCCACTTCATTGGGAAGAACAAGATGTGGATCTATCTGGGTCATCGGCGTC
ACCACCTCGGCGATCCGTGTTCCCTGGTCCGCATCAGTGAGGGTGAGGTGGTCAATCGTTTCTGTTACGGGACTCTGTTCCGCATCCGTACTTGCTTGCA
GTTCCATTTTCTTCCGCTGATAAAACGCCGAAAAATCTTCGAGCACGACGTTCGACTGTGTGCGTTCGTGGAGCTCACCCCACTTGGCTCGATTGAGGTT
CTTGATCGTTTTCTCCTTGTACTTTTTTTCGTCGCTGGAATCCATTCGCTGGCCAATCTTGGTGCCCACGATAAACAACGAGAACAGGATCGCAGCAGCA
ACGCTCGGAATGATAGACGCGGGTTCGTTCCGATAGAGATCCTTGTACAGCGCCTGGAAGTCCAGTCTTTCTTCCAAAGTCACCACAACTTCGAGTCGCC
CGATTTCGTTGCAATAGCAAACCGTCGTGTCCAATGTACTTGTCGCTTCATCGTACAAGCACACATCAGCATCCCATGCCGAGCGTTGAGCATTCCAGAC
TTGACACGTGGTTGTGAAATTGCGCAGCTCGATTGCAGATAAAGCACGATTGTGCGGAATAGAAAGCACAATCAGTGGATGCCACAGGGTCGCTTCACCG
CTGCTGACGTCGTTCGAAGTGAGTCTTCGTTGAACGTTGGCTGCGATGGCACTTTTCGCAGCCACTTGAGCAACGCATAGGCTCGTACTTGAGAGAGTTT
GCGTCCGCAATGCAGAAGAAGAACCAGACGCAGCAGCTTGAACAGCAGCCTTCGAGTGAACCATAACTGCGGTATTGGCTGAGATTTGACGCGAGTTGCC
AAGTTTGCAACGAGAATGCGTTGACGTGGAGAGCACCAACGCACTCAAGAACAGATTGGGCTCGAGGCACGCTATCGCTGGCTCCGTGAGACTTACACTT
AGCGCACTGTTGGACGCCTTGAGTGTGGTCCCAGCAGCCGCAAACGCTTGAATTTGATCAGACGAGATACTAATTGCGTCTTCTTCGGACAGTGCATCTT
GGCTCGCGATGGCAGTTAGCGTGTGGAGCGTAGATATCAGCTGGCTATACGTTGCGTTGACTTGTGCGCTCTCTGCATGATCTTGTGAGCAGTCGATGGT
TGTAGATAGCGCGAGGCGCCGGCTTCGCGAAACACTTGCATCGTTATCATTATTGGTGCTGGGCTTACCGTCCGACACAATGGAGACAACAGTCGATAAC
GAAGCCATCACAATCGAGCCTGCTGTATCAATGAATGCACTTGAGTCTTGGAGCGAAAACGCGTTGTCAACAATGCTGCTACTTAACGACGTCACCTGGT
CCAGCCCGTCTTCGTCGAACACTGATGGAGATGCCTGAAGCACCGTGTCCATGATCACCGCTTGATGTGAAAGTGCAGATACTGTTGGCTCCACCACTAG
AGACGCGGACCCAAGGTTTGCGAGCAATTCAGAATTGACACTTTGCACCGCGTTAGTTTCAAATTCACATTCCAGGCCCATATATCCGTCTTGGCACACA
CACGTCAGTGTTGTCGACTCACATGCGCCGCGGCCAGAGCAGACAATCGTGTCAGAACCCGTCTGAGCGCACGAAGGTGTATCCCGTGAGCCAACTTTGA
ATGCACCCTCAAGAATGGACGCAGCAGAAAGGAGCAAACCGCCCTTTTGAGATGCAGCGGCAATTTCCGTCACACTGACATTGCTCACGAGATTGCCGAC
AAAGCCGAGTGGATCGCTCTTGACCGCTGGCGGCAACAGCACCTCGATTAATTCGGTCGCGTACGCAAAACTGCCCAAATTGTCACTGATAAACGCAATG
ACAGTTACCGATTCACTGTCTTTCAATCCTGCAGGTGGCAGCATTGTGACGGACACCATGGGGATAAGTTGATCCGATACCAAGGGCACGGACTTTGTCC
GCAATAGAGCACCCAGTTGGGTGGTGTCATTCGTGGTGGCCACAAGTGCATCAAATGACAATGTCGACATGACTCCAAACGAGTATTTCAGCGGCATATC
CTCAGCGTCATCGGCCCACTCGGCGCAGTACAGCAAAAACTCATCTTCGATAGCGTAGCCTGATTTCGGAGTCACTTCGAACCTGCCAGAGCTTGGCGGC
GAGTTCACTGTGACGCTAGTCGATCCAAAGCCTTGGTTCCCATTGATATCCGTCGCAATCAAGCGGAAAATGTACGTCATCCCACCTGTCAGCTTGTCCT
TGAGGATGACGTTGTTTAGACTAGTGAGCGGGAGCGCAAACGCATTGTTGTGGGTCGTCCCGTTGACTTTCCACCCGCCTGGAAGATCCAAATCGCCTTG
TAATTGGACCCATTGAGATGTGTACGGGTATGTTGACTTGACTTGCGCGGATAAGATGACTCGGTTAGAGGGATTGATTTTTGCAACCGAAGTGCTCATC
TCAACATCGGGGAGATTGCCAGGCAAGGTCCAAATGGTAGTGGAGATGCTCGTATTCCTTGATGCTTTTCCTGATCCAGAGGCTGCCTTAGCCACCGACA
GCGAAAAGCTCAGTTTGCGATTCATTTCGACGCTGAACGGCGCAATCAATAGAAGAGCTCCCGTCGACTTCGACAGATCCAACTCATTGGCTTTGACCGA
AGTGGGCGCCGACGCATTTACGCATGGTTGAGGTTGCGGCAAGGATGCGTTCGTGATATCCGTACAACTCCATGTATACGTGAAGGGCATGACAGATAGG
TCTGGATCAGTAGACGCGTTTGCATTGAGCACGAGCGTGTCGCGCTCTCCAAGGGCCCGATTTCCACCGGCGATGCTGGCTATCAAGGCGCTTGCGGTGA
CATTGATCAAGATGACCGTCGAGCTGTTGGACGAAGCTTTGGTCGTGTTTTTCATGTACGACTCGATTTGAAAACGGTAAGACGTTTCAGCATCGAGAGC
AGTTCGAGGGATCCGAAACACTCGGGGATCCTTTGCTGTATTCTTTGAGCTGAAGTCTACTGGGGTGTACACTGACCCATTGAACGCTGCACTTACCACT
GACCACTTGTACCCCGCCTGAGTTCCGATCACCTCCGTGCAGCTGATTGTCGAATCGACTTGCAGTACAATCGGATCTCCGAATCGAGCTATCTCAAGGT
TCGCATCACCGATCACAAATACTGTAGGGCCAGGGAGACTTCGCACCTGGATGATTTTCATCGTCGTCGTACGTTGCGCGAATGCGTTCACGAGCTCCAA
TCCAACGACATACTCGACTCCAGGTTCAATTAGCGTGCTGTTTATCTGGATTTTGAGAGATTTGAATGTGGTTGCGCTTTGGGCCACCGATCTCATGTAG
CAAGCAGAACGGAGCTGTTCCATGGTCGATACAAACGCAAGGTCAGGATTTGTAGTCAAGTCTGAACTTGGCACGTATATGGAGCTCGAAGATCCGCTCT
TCCAATCTGCAGCGTACTTTAGGCATAATGCGTCCAAGCTCGCATACATTAGTATTGCGCGCGCACGACTAAAATCAGTATCACCAAGAGAACTCGCAAG
GAAAAACAATTTCGGCAGCGCAAACCAGTACATCTGAGTGAACGCACGTCCGCCCGCGCCCTGAGAAAGTGATGCATCGACCGACCACAAACCACAGCTG
CTGGCGTCGTCAGGAGCAATGAAAATGACCTTAGGCTTGACAATGTCGCTCGGGACTTGAACAGCTACGCTTGCTTGAGTGTATGCGCGACTTGTATGGC
GAGCACGGATGACGTTCGTAGATTGGCAATACTGATTGGCAAATGTTGAGCAGTCGTTCAGCGATAGCACGTCTTTGGTGACAATCGTGGCACCGGAGCC
GAGCTCGATCAACAGGTTTTTCAAATCCAACCAAAGGCAGACAGCTCCGGTACCTAGCGAATACTTTGCTGCAGCGAAATCAAAGACCAGACTACATGGG
AACTGCTTGCGCTTGATCAAATACAAAGATGAGCCATCGATGGAGTCGCTGGGCTGAGCATCGCGAACACTCATCGTGTCTGCATGATACACGCTCGAAT
CAAAAGTCACTTGTAGTTTGGACCCCGACGCATCGAAAATTGCCAAAATCGGGGTTGGTGGCGGAATAGACTCTTTATCATTAACCATCACCGCCACAGC
TGTCACGCCAATGGAACTGTTTGAGATGTTGTAGTTTGCATCCGCACTCGCAACCTCGTGAAGAATAGATGAATACTGAGTTGGATCCTCTGCGATCTTG
TCATCAATCGCAAACACTTGAATCACACGAGGCTGAAACCAGTCTAGGGCCGTGAACATGATCTCGATAGCTCGTACTGAAGTAGGAGATGCGGACATTG
AAGAGCTAGTTCCGTAAACTGCGCCAACTTGAGGCGCTCGAACGACGGCCTTGGTGTCCAGGTTAATAAATTCCTCGAGAGTAGGCTTCAAGATCAATTG
CACGTCCTCGTAGGGCTCAGCATTGAGCACAATTCGGTATGAGTCATTGAACCCTCCTTCGGCGACATGCAGTTGCGTTCGACTCCTTTCTCCAGCAGCC
TGAAGAGAAATGTTGACGTAGGCGAAGTCGTTGTCCGTGATCCAAAGCCTTACTTTGCCGTTGTTCTGGGAGTAATTCGCCACTTGATACAGAGGATCTT
TGCTTGCAGTCAGGTGTGTGATCAAGGCTCGATGCACGGGAGATTCTGTCAACCAATCATCAAACGCGAGAAATGATACGTTCTGCCACTTGCTCCAATT
ACCCGCGCCAAAGTACAACTTTGAACTCAGGATAGTTGCATTGCAGAGCGTCTCCGACGTTGCGACTCTCACATAGCACCCGTGCTTTGCATTTGGAGAC
AGAACGACAGGTTGCCATGGTTCTGAGTTCAGCCGAACTCCGTACGTGTAAACCGTCGTGTTGCTCTCGCTCACATTGAGATCATTGGTCGAAAGCGAGA
TGCCTGAGACGTCATTATCGGTGATGAATACGTTTACGCGGCCGAGATCTTCCAAATTGGCGTAGTTGACATCGTTTGAGCGTATCGTGTGTACCATCAC
ACTCGATGAATCCATGGGGTCTTCCGTGAAATCATCCAACGCATCTACACGAATCGTCTGCGAGATATTCCAGTCTTTCCACGTGAACAATAGACGGGTC
GGTGATGCAACCGCCAAGTTCCCCATTGCACCAACATTAGCGATGTCGACTGTAACTTTTGCGAAGGGCTCCGAACCGAGGACAATCTTGTACTCGTCGT
ACGCACCACCTTCTGTCACAGCGACCGATGTCTTTGATACCTTAAACGCCGATGCATCATCGTCAAACACCGTTACGTTAATCTTTGGGATGGTAATTTC
GTGGTATTTGATGTCGTTGCTGTACGAGATATGGGAAATGCCAGTCACGTGGGAATCGTACTCGTCCAAGTCGTCATCCGTTGCTAGTACGACGACCGTT
TGGGCAATGTCCCAGTCGCGCGGAGTGAAGATGTACTCATTCACTGGGATCGTAAGGTTGCACAATCCAAATCGGTAGCAACCTGTGTTTTTCCCGTCCA
GCCACGGTAAGACGACAATCTTGACATCATATAGTGGCTCCGTTTTCAATTGGAGCATATATTGCGCTACCATCGACCCATCTTCACTCACTTCAAGGTA
CGTCTCAGAAACAAGGATTTCAGAAAAGTCGTCACTTTCTACCTCAACGAGGACAGGATCCAAATCAAGCTTGGAGTAGATCAGATCATCACTGAACACC
GTGTGTGCGACATTCGAAAACGTCACGTTCCCATTCTCGATCGTTTGCTCATCAATGAAATCGTCCACGGACGTGAGACGCACTTGCTGAGGGATGCACC
AGTTTTCGGGTGTAAACACGATCCACGGGTTTTCAACTGTATAGTTGCAGAGAAAGCGCTCTTGAATGGTCACATTTGTGATGTCGTAGACGCACCAACC
ACGCAGTCCAAACGGATCACTATGATCGGGTTTGAATCGTGCTGTTGGGATCGCAGCGCACCGCGGTATCCCATCTAGGTCATATTCGGTCGCCACTTCG
AGCGGAACAATTTCCTGCGTGACCAAGCTCGCATTGATCGTAATCTTCAGGTCCTGGAAGCGAATGTAGTCCTCGATTGCCCATTCTAGCCGCCACGTGT
GACCACCGTCAAGATACGGTCCTTCGCGGAAAACGCGCACGCCTTTATCGAACTTGATACCGCGCCACAGCCCAGTCTCCGGGTTGAATTCTGCCTCACG
GTTCGAGCGAACGAAAGGAATCGCTTCAAGTGCTTGATCCATCCCAATTGCACTCACATTCACAGGCAGATTCCACGTCGTTCCAGTGTACCATACCTCC
TTGTCAATGTCGAACAGGTCGAGTGTGAGCGAGAACTTTCCGCCAATGTACGTTCCGTTTGCAATTGTAGCGGATGTTAGAACGGTTCCTGTCCCTGAGA
ACGAGTTACTCTTATACACTCGAATCGGTGGCACATCCCCAGGACTGTTTTGATAACTAATTGTCCATGTGTAGCCGTTGCACACAGTAAATGCATCACA
GTCGAGATCTTCGCGCGAAATATGCGTCAGCTCAGTGATATTGAGGTCGAAAAGTGCTTGCTGCATCGCTACTGCCGAGATATTGAATGGCAAATCCGTC
GTGTTTTTGTGCGCCACGTCCATCCAGTACACTCGCTCTGTACTCGGGTTTCTTTTCTTAAACAGACCGCCCATTTCGACAATGAACGTACCTCCCAGCG
ATTCGCCGTCGCGGATAGTGTCGACGACTATCGTGACTTCCTTTCCCGTCAAATTGAGCGATCTCACTGTGAGCGGATCCATCTGCCCGTTGTTCCCGGT
AAATTCGACGGTCCACTCCATTCCGCCTTCAGCAGAGAGCTGTCTTCTGGATACGGATACATTGCCAAGCCCGTTGATGCGCGAAATCTCTTTCTTCAGT
AACTCTTCAGTCGCATTCCATGGCAGTGGTCTTGTGGTGGTAACATTGTTTGTCGAGTTGAACGAACTGATATACTGCACTTGGAACATGCCATTGATGG
CAATTGGAGCTTGCATTTGTGTGAGGTTCAGCGAGATTGCGGTTCCGGATTTGGGGGCCGCCACCAAAGTCGATGCATCGGCTTGCAGCGAGTAGTACGC
ATCGACGTTACCGAAGGTGATTGTATACTCGAAGCCATACGCACTCTTGTGCATGGAACGAGTGACTGAGACGGCGAACACAGCATCTAGGTCGCGCAAT
GCGCTTTCCAGGCCATCTGCTTTCACTAATGCGGGTACAATGGTTGCCGCTGCCTCAGTTGCCCCATAGCGAAGAAGAAAAGATCCACTCGGAGGCACAC
ACACAGATGAGCGGTTAACGGATAGTGTACCATCAAAAGCAGTGTCGAGCGTCACAGAGAGCAGCGGGAACGTGCCGTTTTCTCTTAGCAACCGTGTGAA
CGTGATCGCCCAGTTCAAGCTGGATTGGTCATACGACACGTTGCGCGTTACTTGGAATGTCTGCTGTGTCTGCTTGAAAAGTGTTTGCAATGCGGCTTCC
ACACTTGCAGCCGACGAAAACCCATCCAACGCGACCGTAAAAGTACTACGATCAGAAGCACTGATACGGAATGTTCGGCCGTACGTGACAGCATTTTTGA
TCGCATCCGCCGACTTAAATCGAAGCTTAAACGCATCGTCAAACTGGAAAATTACCACTTGGACTTCCTCGGCGAAGCCTCCAGTCAGCTCGAGTCGATA
TATGTGATCAACATGCTCCGAATACGTGACAATTCGCTGCACTTCGATGACTTTTGGAATCGAGAGCGAGATCTGATGAATCTCGCGGGTGGAATTTGTG
CTCAAGCGAACCGAACTGACGCTCTCCTGTCTTGGGAGTCCGCAGGAGACACTGTCAAAGTGATATCCGCATGGTCGATAGCACGAGTGGTTGGCCTCGT
TGCTCATCGCAATCGTCACGTTCGCCCAGGGTTCCGTTGCTAGACGAAGCATGTACATACTGCCGGTGGAATAGTTGTGCACCAACCGCGTTGACCCACT
ATCCGTCTCTGATAAAGTCACGTATTTTGTCGAGTACAGCAAATCGGTCTCGTCATTATCTGCAACAGCGACCACGACATTCGGCAAGAAGAGGTTGTCG
TACACTGGATCAACGCTCTTTGATGTAGACTTGATGCTAGTCAGATGCATATCGGCTTCGTCCAATTGGTCATCAACGGCGACGACACGAACAGTCTGAG
GAAACTTCCAGTTGGATTCAGAAAAATAGAGTGTATCCGGAGAAATGGTGATATTGCAAAGCTTTGTCGGAGTGCTCTCGTCCCCACAAACCAATAAATC
ACTGCCTTCTTCTCTCCGCGCCTGGGATGGGCACAATGGCGCCTCAATGCACTTTCTATAGCATTCTGCGTCTACACTGATCGATATCTCCACAACACCC
TTTGGCTCCGACAAAATCATGACTTGATAGTCATTTCCTTTGCCATCCTCGGAAACGACTAGAGAGCTTGTCGAGAACTCAATTCCAGGAATTGTCAGGT
CGATGAGATCAATCGAAAGAGGATCAATCGTTAGGTTCTTGTTGTATGGCTCGTTGACAAGCACATTGGAGTCCATCTGCTGAAAAGACCACATTGCACG
TAGCTCAGCGAATCTGTCTTCACGAAGATGCAAAACTTCAGGATCTTCCAGCACTCGCAAGACTCGGAGTTCTTTGTAGAATTCGCTGACCAGGTGCTCG
TATTCAGTCATTAAATCAATAGTCGAATCTTCAATACCGCTCGCAAACAAATCCAAGGTTGTTGCAGATGACACAAGTTGATATGCTGGTTTACTGAAAG
TTTCGTGCGTTAGCTGGGTAATATGAGCGCCTTCAAACAACTGGTCATCGGTGGCGATAGCATGAATGGTTCGGAGCTCCATCCAATTTTCTGGCAAAAT
CACGAGTGCGGACGGAGTCACGGTTACGTTGCACATATTAAAGCGATAGCACAGAGATTCGGCGTTGATGTCAATCAGAACGGGATTCCATGGCTTCGAA
GTGAGTCGCAGGGAGTACGAGTTGTGCGATGGCGTCTTCACGTTTACCACACCCCATAAGAAGTCATGGTAGTGATCCAGCATCTCTGATCGTCCCAGTG
CACGAACATACCACGCAACATTTGAAATCACACCCACAAAGCCTGCTTTGTTCACTCCAGCGGACCCCTTGTACGCTCCAAAGTTGAGGGTTTTCTTTGA
GATACTGAGCATCGCAAGCGAACACGTCGACTGAGCACTCATCAAAGTCATTGTAGCTTCATGAGTGTGGCTGTAGCGGATTGTCAGGGAAATGATCGCA
GACGACGGATCGTACGAAGCAACGACATGATAGTAGATCGCGGTTGATGGCGAAGGCAAACCTCTATCCATGGCAGCCCTGCAACTTTTCCCGGAAGTTG
AGTCTGTGAGTTTAAAAATCATAGTTGATGACATACTGGAAATCCCAACGGATGCAAACACGATGCTTCCGCTGTCCAATGTTACAATATTGATAGATGC
GCTATCTGCTGACGCCTTTGGGGCTTGAGTGAAACGGAGCCAGAATTCGAGCGAAAACGAAGGCATCGCAGCTTGGACGAGAACAGCATTTGAGAAAAAC
GTGTCTTCTTTCGAATCACCAATCAGAAACTGCTTTGATGTCTTCACCGACGAGAACGCAAGGACACCTGCCGCTCGGCCTTTTGCTGCGCCGACCACGG
CACTGGCGATTGGTAGCTTAGGCTGGTCATCAAATGCCCACAGCGCAACTGGGTTGTCTCGCAAAAGAAGAGCTCGATGTTCATTTTGAGACAGCGGTAG
ACGTGCGAGCGGGAAGAGTTCCACTACTCCGAAGAGTATGAGATCACAGAAATCACTCAATACCAGCGTCAAGGCGGATCCGATCGCCATGCGCTGGGAG
TTGCAAAATTCCTCTCCACAGACGAACTGCTTGCAAGAAGATAATGCTGCAGAGCTCTTCACAATCCCCATTGAATCAATTTGGCACGTATCAGCTGAAT
AAACAGCCAGTTTACTGGACGCATTGTCACTCCGGATACCATCGAGGGCAGATCCATAGCCAGCAATGGAGATTGAGTGAATTGAAGCCACACTTGAGCC
GCATTTGTCAACATTTGAGTCAAACTCAATCAGACCAACCTTTGTGGGTTTTATGAGATCGAGGACAACCCACTCATGAAATGACGTTTTTGCAGCAATG
TAGCAGTCGCTATTCATCACATCCGTTAATGCAAGAGCAGAGCCGGAGCCTGTGGTCGCTAACTGAGAGCTCACGCTGTGGATGTTGAACGGAATTGGTA
GAGCATAACCACCAGCCGAAGCAGTCACGTCGGTCGGAGGGAAGAGTTGAATGCTTGACAGTGCCATCGGTTTGGCACCGACACCGTAGAAATTCAACAG
AAGATAGCGAGCAGTTGAACCTGGGTTCCACTGATACACTTCAACCTCATTCAGCATGAGGACGCCGAGTCCGTGCTTTCGCACTGTCACGAACCTGCCT
TTCGTAAACGCGTCAGCCCAACCTATTGATGTCGTCCCGTTATCACAGGAAAATGCCAGCGTGGTTTTCTTGCTCACAGTGACGGTCGTGGGGTCTGATG
CCATGGCAATTGAAGTGTCTGTTATGAGAACTTCAAAACTCTGCAGGAATGGCACTTCAAGCATCAAGAGCCGATCAGTTTTGCTGTAGCTGTACAGGTC
ACCACTCCAAGCTGGAAACTGGTCGGCAGGATTTGAGCGACAAAAGTTGCGTCCATTTTCTCCAATGAACGGATACAACACAATGGAACTGATTGGCTTC
ACAGACCCCAAATCGACTTCCCACCATGGATCCATCTCGAGCTTAGTTCGTGTGCTTCCTGGTTCCATGGCCAGATTATTTTCACTAATCAAGCCAGCGT
GGTCGCCTTGAACGACTATCGCATCCCACACTTTCGCGCGTTGTCCATCAACCGCGAGATACGACAGCGCATTTTCTGGACTTGCGCTGCTTTGACGAGT
CTTCATACCAATCGCAATATTTTCATCTTCAGAGTGCTTTGCGCTTTGCTGTACACGCCACGATTCGGAGGCTTTTTGTGCAGTCCAATCCGTCTTTACC
CGTGATCGGAGACCGCTCTCATCTGCTGTTGGAGTAATCGACACAAAAGCGTCGTACGCTTCCACTTCCACCAGTTCTAGTGGCCCTGATCCTTCTCGAT
AGATACGCAGACATCGCATGCCAGCTTGAATGTCGCGAATAGTTATACCAGTGCGTACTGAAATGCGTCGAGAAATGGGGCACGCTTCTGGACAACCATA
CTCAAGCGCTTCATTTAGCGGCATTGCTTGGCCTTTCAGCTCTTTCAGGGTCACAATCACAACAATGTGGACGGCATCACTCACAGTGTTTCCTGTATAC
ATGGTCTCAGGTAGAAACAACGCTATGCTTCCAACTTTTTTCGTTTCCGCAAAGCACGTTTCCCACCAAGGCTCCATCTCCGACTCCGTTGATGTTGCTT
TGCTCATATCCCGGTCTCCATTTGTTGCGACCACTGCTGAAAAAGGACTTGTGCCATCGAGCGAGTTGGCCGTGGAGCTTTGAGTTGGTGAGTTGTGTAG
CAACAGATTAGGGAAAGTATACCCCAGCCTAAGCGTTGGTCTTAATTTTCGCTCAAAGACAGAAGAACAAATCTGAGTTTCAAATTGCGTCATGCCTTCC
AGCCCATCGATCACTTCAATTTTGAGCGACACCACCGCAGACCGCGTTGGAAGGAGCTGCGCTACGAGTGGCGTCACATCCACTTCAGCCGATTGACTCT
TCTCGACAACTGCTGTAACCTCAATCGACTTGATTGCGACAAATTCTAACTCACTTGGGAGTGAAGCAGTATCTCCAGCTGCGCCAACACTTTCCGGAGT
CCATGAGTTTTGCACAAGACTTATCCGTAGTCGATAGTATTTCATGAAGAGTCCTGCGTCACTGCTGCTCGATGCCGAATCATTCGTTGCATCCGACACA
TTAAAAATTTTGAACGGAGTTTGAAACAACCGTAATGTCGAAAAACTAAACGCCATATTCGAGTCTCCCTCGTGCGTGTACGGTAAGTGGAATTTCATGT
ACGAGGTGTAGTTCGAACCGAGCACGAGAAAATTCCGCAGTTCATGTCCTCCGTCATCAATGTTTCTCGTCGACACTGAGATATCGCTGAATGCAAACGA
CGTCGCATAATCTCCAATCCAGTTAATCTTGTCGGCTGACTCTTTCGTGGTGACCACGTTCTTCGGCTGGTCCACGACAATTTGCACACCTGCCTTGTCA
TTGTCTTCAACAGCAACATTAATGTACTGATGCGACGGCGAGTGCAATATCGTTGGGATCATGTTGTACGGAATTGTGTCGCCTCCAGTGGTTCCACGAG
GGAACAACAGTGATGGCGCCGGCTGGAACGTGCCTTTAAACCAAAAGGCTGTCGTATTTGTGTAGCCAAGCGGAGAATTTTGTACGCGGTGAGTAATTGT
ATACGTCGCATCAACTTCTGTCATATCATCATCGACAGCCTGAACTGTAATCCACTGGGGAATGAACCAGTTCCGTGTCGTGAACGTCACGACAGACGGC
GAAACTGTGATCTGGGAATTTGCGATGATCGCAATGCTGATGTTCGTTGAGCTATCTTCGTTATAGATAACGGGTGCTATGGTGGAGAAATCATCCGCCC
AGAACCCGCATGTATCCGAGTTTGCTTCACGGCATATACCATTTACAACCCTGAGCGAGCCACCGTCTATTGATGGCGCAGCATTCAATACAATCGAATA
CGTTGCCATTGAACCGTTTGTCGAGCCTTCAGCTGACTCTCTAACTGTTAACGACGTTGTGGATAACGTCACTCCCGGGTCGTTATCCCAAATGCTAACA
TCGATGCTGTTTCCAGGGCGAAAAACACTCGCACCACAATTCCACAGGCGCCGCTCGTCGATGACTCCAGGGAACATTTGTAAAACTGTATGGAGAACTC
GATCCACGTACCCGCTTGGCCACTCTTCAAACGCCCAACGATGCGTCTCCAGACGACCGATTCCTGCACACACTGCGTGAAGCGTCCTCTTTGGACTCTT
CCCAAGTTTTTGCACTTGATCGAGATTGAGCAAGCCTAGAAAGCTCAGCACAAATCCACGGAGCTCAACTGGGGGAGGAACAAATGTCAGGTCTGTGCTA
TTGAGAACAGCGAAGATATTGCCATCAATCTCTTGATCCTGTAAGACATTTTGAAGCGCGGTATACGCCATTGACGCCTCTTCAATGCTGGCATCACGAA
GACTTGGATTGAGAGCTGGACGTCCAAAGCGAGCAGGTATGGTTTCCACGTCAGGAAAAACTCGCGCAATACACGCACCGTTGCCTAGAGTGAAATTGCA
ACCGCTTGTAATATCACATACTCGGACGGGAAGTCCCTGTGCTTGGATATCGGGAAGGAGGCAATCACTCTCGTTGGCCAAATCACAATTCGGAATATCG
AAGCATTGCGGACGCCGTGAATGATAGCGGAAGTCATTGCTCTCACTGTAATGAAGAAGCTTGCCCCCGTAGTGGAGCCCTCCAAACTCCACCTCTGAAT
AGGGATCATCAATCGCAGCCACGATCACCGTTTGCGAGATGTTCCATGATTCTGGCATAAACGTCAGCAACGATTCGTTCACGTGCGTCTGGTTTGGATG
CAAAGCGAGAACTGTGACAAACACCGGGTACCACGGCCGTGAGTTGAGGACGACTTCGTAAGTGTCAGTCAGTCCCCCTTCTCCAATGTACATGTGTGCT
CGCGACAGTTTAATGCTTGCAAAATCGTTGTCTTCGACCTGCATCGTGATGTTTCGCCCATAAAGAAATGGTGTCTGCGATCCATTGAAGTTTGGGTCAA
GGCTCAAAGACGAATGAGTGATAACTGAATAATGGACGCCTTCAGCGATCGCGTCGTCAACTGCTATAACGCGAATAATCTGCTCTTGATTCCAATTGCT
TCGTGTGAACACGACTTCGTAGAAGGTGTCGTTAGGAAGTCGCAGTTGCTGGACATTCGTTTCGTTTGCGTTGACAAGTTGCACAACTTCTGCACGCACC
TTCACGTCATTGAGCGGTCTTCGATTTAGCACCACACTATACTCTCCTCGCACACCGTTTTCTTCGATCCTTTGCCTTCTTGGAGTCAAGGTAATCCCTC
CGTCCATCGTAAAATCCAACAAGTCGCCGTGGAAATTGAAGCTTGCTGCAAAATCGTATTGCTGAGTACGCACGCTTGTTCTTGTGTTGGGATCCATCAT
CTGCGACTCATAGAGCGAGAAAGGTTGGCGAGCTTCAAGCACATCCTGCACATCGATCTCGACTATCGTATCCACTTGATCCGTAACACAACCGCCGGAA
AGCAAAAGCGAGTTAAATGTGCTATCAAGAGTGACGCCATACCCAAAGTCATTCGCTGTGCTGCCAAACTGCGCACAAAATACTTGTAAGCAGACCATTT
TCGATTAGAGCGAGAGAGCTAGCAAACTTACTTGTCGCGCCCATAGCTTTTCTCCGTCTCGAGTCAATTTCAGAAGTACAACGTCTCGACCTCCAAATTG
GCCAAACCCGTTGAGAGCATGCGCTCCTTCGTCCATGTACCCCCACGTCGTGCCAACTACGTACAGCATTTCCGACACTGTGCCATCCTCGCTGGACGTC
TCATTTACAAGAGTGACAAAGTTTGCTGCATCTGTTTCGTTTGTACCAAACTACGCAAAGAGAGTTAGACAACAGTATCCGCAAGGCTAAGATGATAAAG
TCCCACGCACACCTCTTTTGTCCATGCCAGCGAGTCATCCGCATCTATCCTCGCAATAAATATGTTCTGATCGTTGATTGGATCGGTCTCGGCGATGTAG
GTCTTCGATCCAACAAAGTACAGGTTCCCATCGGCATCGGCCACTCCTTTCCCAACGATGTTGATCTGTTCATTCGGTTCTGCTTGCTGCCAGTCGTATC
CTTCACTTGCCAAGCGCCAAGCTTGAGCGTCATCAGCAGTGATAGTGTCTACCAGCGTATATGCCCCTTCGAAGAGCGCAACCACGAAGCAGCACACCGA
CACGACTTTCTTCAGTGGAAATCTGACAGCGTTAGATACAGCAGCACTCATGCGTGGCTTCGTTGCTTTGCTGTGTGGCTTGCTTACTGTCGGTTCAAAT
CTGCTGTGGCTGGCACAAACGGACGCCGCCCTTTCGTGTGAATAAATCAAACGGTCAACAGAAGCAGGCTAAACACGACACAATATCTCTGTTTGTATTC
TTTGGGTTGGTAACACAAGCTTAGATCAGTTCACTGTCATCATCACTATCGTCAAGCTCGAACGAAAGGTCATCGACTTCTTGCGTGAGTTGGCTGAGCC
CAGTGAGTTCTTCGAGATACGAGCTCGAGTTGCAAGCATTCTCCAAGAGCTGGAATGCGTTACCTTCGTAGGCTGCCAGCACCTTGGCGCTGCAAGCAAT
GCACTTGTCAAACGATTCACCAGTGATGACCATTGAGTTGAATGCATTCAAGAACCCTCGCAGTTGATGTGGAATAAAGCCCATGGGAGCTGATCCATCT
GCAGATTTCTCAGCACTTGCGTACTTCCCGTCTGGAGAATGGAGCACAGCAACCAGCAGTTCCACTGCAGTTGCGGAGGCGATCGGTGCGAGTCCTGGGC
GTGTCACGGTGCACATTTGGTCCAACGTACGATCTTTCAATGAGTCGCGTGGACTAACGATATCGTTGCAGAAGTAGCATCCAAGCGTTGCTGGGTTCTT
TTCATCCGAGTTCGATCCCTGGACTCCATGACGCATTACCAAATAGCTATCAAAACCAAGAGCAGTATTCAAAAGCAGCTTCTTCTTCGATGCAGCGATG
ACAGTTGGCAGCCATCTACTCTCGCGTGAATCAGTTCCCAAAAATATGGCGTCGTGCTCCTCAATCAGCTGTTCGAGTGTTTCAAGCCCACGTTTCGCTT
CGCCAATAAGTTGGTTATTACTGAGAGCATGCCCTGCCATCGGAATCGTCAAATTCACCGCTTTCGAATCCACAAGCGGGAAGATTCGCTTCAGCGCATT
CGCAGCACACTCCCCCTTCGGCTTGCCGCAATCTTGGAACTCGAACAGTGGCTGACGAACCGGATTGGAGTGGCTGACAGTCGAGTTATCAACAAATGTA
ATATGACGGAATCCCCATGACAAAAGACTTCGAGCAGTGTAGCAACCAAGCGTTCCAGCGCCGAGTAAGAGGCATTTCGTTTGCGCAATCTTGTCCAAGT
CCAACGACGGCAGTTGTCTCCAGCGCATCAACTTCAAGTTCAGGTCGACTGACGTTTCAGCGAGTCGAATGGGATCCAGAATCCCGCCAAGCTCCATGAT
CCGTGGACCCAGTTTTCCACGAGCGTTTGCTTCCCAACCCATCATACGCACATCTGTCTTGGATCGACCACTGGGTAAGAACGGCTCACTCTTCACCTCG
AAGATGAGAGAGTTGTTGCACTCAAAATCGTCTGGAACGTCGCTGATGTGATGCAAGTGTTCTCTGAGCGCCAGGATTTTCAGCGGCTGGTCACGTGAAA
TTTTATCTTCTGGAAGAGACGAAAGGAAGGCGAGATAGTTTCGCAGCGGCCAACCTGGATTAGTTTTCAACGGGCAGGGGTCAACAAAACCAAAAAGCGT
CTCGGTAACCTCCTGTGCGCTCTCGGCTGTTGCTTTCCACGACTGCAAGGACTGCACTCGAACGACATCCTCTCCTGCATCGGCTGCTTTTAGTCGTTCA
ATGACAAAGAATGCGGAAAATCCTTCCCTGCTTGCACGACGCAGCTCAAGCAGCCCACGAACTGCTTGCGCCTGCTCCTTTGTCGATAGCGCAGACGATA
CTGAAGTTGGAGCTTTGCTTTTGTATGGTGTTGCTGGAGTGAGCGCTGGAAACCCAAACCAGTACAGAAAAGAGTGCTTCTTCAGATCCGCAAAGGTCAC
CAATACAAACGAGTTTAAACGCTCTACATTCGATGAATCTCCGACGACCAAGTCCAAAATTTTCTCGCCTGCTTGTTGCAACACCGTGGCCTTGTCAAGA
TTCTTGAAATCCTGTCACAAGCGAAACAGAAATGCACCACAAGAATGAGCATTCCAGTGACCAACAAAATATGCACACAAACCATTGTAGAGCAGGCTAC
ACGAACCTCAAGCGTGTTGGTGTTAATTAAAATCCCCGGCGCTTTCCACTCATATCGCGCTCGATCCACTGCACTGCAAGGTTGAAAATCAATAGTAGAA
CAAACGGTTAGCACAAGGACAGTTACATACATAACTTTCTGCATCGCTGTTACAACCCAGAAATCGCATGCTCACCTTGCATTTTCCTGCCCATCGACGA
TTGGGAACGAACTGTCATCGATCGTGAAGCGCGACGGCACGTTCACCGAGCGTCCAGGCGTGAAGTACCCCGTAAGTTCCTATCATCAGCGTCACATAAC
GTATCCATACGTTTAAGCAATCAAAAGCTAAGTTCACGAATCAACCCATTCTCCACCCCAGATCCACTTGAGTAACGAAATGATCCATTGTACCTGCGCC
TGGTCGTTGAGCTGGAAGGTGTTGAGTTTGAGTGTCGCGAGCTTCTGCCAGAATGTGACGTCGGGCGAGCTGTTCCAGGGTTGGAACTTGAGCACCTGCC
ACTCCCCCGCGTCGCTTGCCATCTCTTCTTCTCTTCTGCTGTTCTCAATGCGGAATGCGGAATGATCGTCACTCCCGCATTCCTTCTTCATCGCTTCAAC
TCACACCGCAGCAGACAGAATGAATAGATTGAGCACTTTCAAGGAAAAAAAAACAAACTAGGAATACCTTTCCAAAAAAATGTGTTTGATACAATGTATG
AAACAGTTGTTGTGCTATTTTAGGAAATTGTCCTAATATTTTTTTACAGCTAGGACAGTTCATCTTTGTTTAGGATTTTTTCTCTCATTTTGGGCTTTGC
TTTTCGTCCCTCTTCGACTTTCCTTGTTGAACCTCGAACATGTGGTGGCGCATGCGCATCACCATAAAATCTATTCTCTCTCCTATCATTCGCAGAAATC
CCTCTTTATGCCATTCCCATTGGCTAAATATCCAACATCCAACAAAGTGAAGAAGAAAAATTTGGAGCTCTTCGTGCACGAAGTACTTCTTCACCTCACC
TCATACTCACTTTCTCTATATCGAGTTCGTTGAACATGGTGATGGCGGTGGTGCAACGCGGCGCAGCGCTCGCCCTCGTGGCGCTCTTGGCGCTCAGCTC
TGAGGCTCCAAGCGAGGCCAAGCGCGTGTGCACGCGCACGTTCAAGGGCCGCGAGCACTTGCACCCGAGCGTGCATCAGCTGCCGGCGTTGAGCGTGGAC
CAAGTGCTGGAGCTGTCGACGTTCCCGAAGAAGCTCGACTGGTGCGAGCAGGGCTTCTGTACGGCGTCGTGGAATCAGCATATCCCGCAGTACTGCGGCT
CGTGCTTTGCGCATGGCGCACTCTCGGCCGCGCAGGATCGCATCAAGATCATGCACAAGAAGCAGGGATATTTGGGACCCGACGTGATGCTGGGCCGCCA
GACATTCCTTAACTGCGGACCAGCGCATGGCCTCTCNNNNNNNNNNACGTGTTTGAGTTCATGAGCAAGTACGGGCTCCCAGATGAGACGTGCCTGCCGT
ACAATGCGACGGACCACAAGAAGTTCACGCAGACTAACGGCACGTGCCCTCCGGAGGGGTACTGCATGAAGTAAGTTTTATGTGGACTTGTTGTATGAGG
TGCCTCACCTCGTTGACTCGTTAATATCAACCTTTTGACGCTTAACTGTATGTGAAATAGCTGCATGCACACGCCAGAGAGTCCTGTGGACCCGGTGTGC
TTTCCTGTGAAGACTGTCGTGCGCTACCGAGCCAAGGAGTACGGTCACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGAGCACGCCATGATGAA
GGAGCTACTCAAGGGCCCCATCACGTGCGGCATCGCGTGCAGCGACGGCTTCACGTTTAACTACTCGGCTGGCATCTTCGAGGACAAGACCAACTTCACC
GACATTGACCATGACGTCGAGATCGTGGGATGGGGCGAAGAGGATGGTGTCAAGTATTGGCACGTGCGCAACTCCTGGGGGACGTAAGTGCCATGCATGC
AGTATTTTGAAATGTGTGGCTGAAAGCTGGTCTAGAGTGGAAAAATCTAAGCGTTGCTGTTGTATGAATGCTTTTTTTGCACAGGTACTGGGGCATGAAC
GGCTTCTTTAAGATCGTACGTGGTATCAACAACCTCGGCATCGAATCTGACTGCCACTACGTGATTCCCGACATTTCGGACGAAGAGCTTGTATTCTCGG
AGACGCCGATCTACGGCGGCTCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTCTTGATGGACAAGGCGGCCAAGCGTCCAGTGCCCAG
TACTGACGACGTCGTGTTCAGCAGTGTGCCGTTGCAGTCGGAAGAACTGCCTGATGCCGAAGACGATTCGGATGACTCGAGCGACGAAGCGGTCACTACC
GACAACTCGGTGATTTTCCGTCTGCCTCAAGCGACCCGTAGTCACAGTGCTGGGCTCTCCATTGCGGCGCTCTTCGTGGCGTTCACGTCGTTCGGTGCTG
CCGTCGGGTTTGTGGTCGCTCGCTTTTCCCGCGAAACCACGTACTCGCGCATCAACTAAGTCGTTTTCGGCGAAGCGCGTGCTGTCGTCTTTCAAGCCTC
AGTAGAGAGTGAAAGCAGCAAAAAATGCGTGACTTCATCACGCAAAGAGGTTTCACTGCCTGTTGAGGTTACGAGAATGAAAGGATAGATTTTGGATCCA
GTTTTGTCACAACGTGAAGAGAATCCATTTGCTTTTTCTTCTCTATACCCGAGTCCAAATCTTCATTTCATTTCCCTGCTGCCTTCGTTGTTCATTACAT
TCATGCTTTACATCAGCAAGCCAGGAGAAAGGACTCTGAACTCGTTCTCGTCTCGAATTATCAAAGGTTAGAGCTTCTTGTCAGAGGTCGAAGGTGCCGC
AGCTGCTGAAGTGGTAGCCGCCTGCGTGAGCACGCGACGGTCCCACGAGTGTTCGCTCTCCTCCAGCAGATGCAGGTAGCTGGACTGCAAGTGCGTGGGT
CTCGTCAACACCTGCTCCACTTCCGACAACTGGTGCTTCTTCTGGTCGAGCGCCTGCGTGACAGCGTCCAGACGCGCTTGGTCGAACTTGGCGTTCGCGA
CCAGCTTTCCCAATTTCTTCTTGTAGAAGTAGTCGTAGATGTTCTCGTACTCGTACTCCTGGTTCGTGAGACTCCACCACGTGTATCCGACAACGCTCAT
GCCGAAGCCCGTGAAGTACGTCACTGGTTCCATGATATCCCATGAAAAGTGGATGAACGAGAGCCAAAAGTACAATCCAAACGTGCCGACAAGCGACGTC
GAGAGACCCGCGGCGATGACGTTCGCATGGCGTGTGGCGGCGGCATGGAGCTCCTTCCGCAGGTTCACGAGCGCTACGTGCTCGGGTTCAAGCGACTGAA
TCTTCTGCAGCAGATTCTCGCGCTCTTGCACAAATAGCTGCTTAGTCACAGGGGAGAGACCGATCGACTCCAAGTACGAGTCGATCACGCTGCGTGGTTG
CAGGAAAATCGAGTGCTGGAGGTCTTCATCGTCAGACTACGAGTCATACAGAACAAGAAATTAAAGTAACCTAAGTGCTGCTAATCAAAAGAATATTTCA
AAAGCTACGTACGTTTCGGAACGAGAACACGACACCGGATTGATGGAAGGCGTTGAGGATCTCTGACGCTTGCTTCTTTGGGATGCCGTACTCTTTGCAC
ATGAGCACAAATTCCTGTACACAAAGCGTTAGTAGAACCGCCACATAAGTATAAGCTTTTCCTAATGCCAACATAAATATATGCGCAAATTTGCAACCAC
GTACCGCATAGCTGATCTTCCACTTGCCCAAGGTCTCCAAGGCGTAACGGAGCGAGATGATGGCAGATTTTTGCGCAACGGAACGCACATCAAGGTCACC
TTCATCGAGCAAACTCACATAAGCATTGCCTGTAAAAAAAACGACAACCACGTAGACTGAGTTATCCGTTTTATGTATAGTTTCTTTAAATGAGGCAGGC
ACGTACCAGAGAACACCGGTGCGGTCACAGGGAGCACGCGGTCGTTGATCAGGATCTCGAAGTCGTCCTTGAGGATGTTGTTGAGCGTGTCCTCCGGGGC
GAACGACTTGCCGCGCTTAGAGCGAATGTCCACAGTCTGCACCGACTTGTCCTCAGCTTCGATCTGCGCCTTGATAGCCGCCACAGTCGATTCTACAAGT
AAAAGCACACACAAAGGTTGAGCACAAGTATCCACATATGCGCGTGCATTCAACAATATATGCATAGCCTACCTGGCGGAATGCTAAACACGCGCTCTTC
GTCAAACCCGCTCAACGGCAATGGCACCGCGAGCGTGCAGCTCCCGTCCTTGTACTTGAGCTCCAACGCACGGTTTGCTACCAATAACAACATCAAGGTC
ACTATAAGTCCTCAAACAACCCAATAGTGCAAAGGGAAAGATACTATGTGTACGTACATCGAGCGTATTGGAGCACGGTGGTGCTCGCGATCGAGCGCTT
CAAGGTGGCAAGCGCGAGTTGCTGC