Description :
From Genome Similarity Track
Location :
Scaffold_72:20727- 26879
Transcript NameFunction/comments
Phyca_LT1534555305Hypothetical protein
Phyca_LT1534537040conserved unknown protein

Sequence
6152 bases(100 bases per row)
ggcgacctcctctcttgaccgcctccttcctggccttccacgtgctctccctccctccccgacgcatagccagctccaactcctgctccaggtcgttatt
gcgcgcgtcgaaccgctccagttcactcagtgcgatccactcgaacaacggtatgatacttagagcccccggggccaaaagagtcgtagccacttgtcta
gcgaatctcacagcgctctggggagtggggaaacactggtaaacgtgcacgacgatcgcttcaatgcaagtggctccggttggttgcagacagacgctca
cacacgcgaagcgctggcctgtggcctgcggtaggtctgcggcgctgaattgggcatcatgggggccgacctcactggcgtctaaggcgacactggggaa
gttctccagcgccatcgtcatctcgtcctccttgtacactgcgaagcggctgcagtcgcgaacgtctgatatccctgcggtcttctctactgcgcagatc
cggcggaacagctccagggcgtcctcgatgtctcggaacttaccgaacacccggaagcgcgtgaactctgggtgcgaagcaacacttacagctgcaaccg
ctgctttacggagctgatccgtagcagacttcgctgatctggatgttttgctggcagacaacaatgagatgcctctggaaaccggtcgggcggcctgttc
tttcatgaaccccagcacagcaaaaggctggcaaacgccgtggatgggatcccaaatcgtggcagcagtgacaacagtagcggtcgacgctcctactgta
ccgttttttgctgcggtgagtgcattgtcgagcttctccactcgaactcgtccacaccgacgcaactcacttcggaattctgttgtcactgcagtgatgg
gagacgccgtagtcagcagtacacgggggctcttttctatattgctgttgtcagctcggcggttcagtgctttactactaccggaacgggtgagggtaag
cggcagtgagtgtgaagtagagattgactcgtcatgcggcacagggggcaacttcgcccgacttcctccatgctgtaacttcgtgcttgttgaatgctcc
tgctcaggattctcttgggatttactttgtgtttcctccgtagttatggtgctttctggggcttccttggggcttccgtttgtttgctttgcatgcgttc
cagagggactgatctttgatactcctcttcgacgctcaagcatgagagaaccagggtcaaccaatacgcgagcatcgttcagcggcagtaacggagcaga
ctgggatttgcctagcgtagttctttggtggatggagactgcacctcgatcggaccgccctccaagtgatccaaacgcttgagggtggctttcagtcatg
acactgctgatgaactccttcttgtacttctcccatgcaacagactttaaagctcgactctggatggactcacgtatgtatccgtttgaagatcgctgca
gactcgctcgagcttctgctgacatgaggtggaaaatatcaaaccgtgaaagaacgaggattttcatgggcgattccgccaagatggagtattcgcgtat
gaaaatgtcgttgaatctccctgctgatgccctgtgaacggcaacacgtaagcagcagcatttcacccgtaaaatactgctgtcaagccttactctgcgc
agcctaaaactgaatttggtccatatctcccgagctcgtagatctgtcgcgcattggtgatagggtgctttccttcatttatgattcggcactcacctcg
agttacgatgaacagttcactggctcgagatccctatttacataaaaatctgttagcaaaccgaagccccatcgaaagcttcccgatgattttcgactct
acctgcttgcagatttcgcctttatacgggatatacttctcagtcatgaccgaacacataccttcaatagtgttgtcatcccactcaggtccaaggaaat
acgggttctttctcagcatctgcgcgtattgagcgtgatactcgttctggtatttcttgatcaatggctcgtactcatcgcgaccgagaaccagcagctc
gcagaactcggtacatacaacggtagcacgacggacaccatcagcttgggaaagcgctagctcaccgaaatactcgccttccccgagccttgacacaacg
ctttctttcgtctcttcgaagcgattcttcgcgcggactgatacgtccacgcaaccagtaaagatgatgtaaaaatgcctccccacttgcccttcagcga
aaagcacagtgttcgtgacagcactaacgagccgcatcacattgcacagctgcttccggacttcaaacgagaaccgtgagaagaatttgacactctttag
gtattcaacagcgaacttcaaatctttttccgatcgttgagccgagcttcgcatgaagatattcctcacaatgtccttgttgcttcggaaacgcttggta
atctcgagcgtatttgtgttactcgagtcatgtgactccttgaggagctcgctaaacacgactcgattgataaaaacaagctccgttggagcacttagaa
caatcacggatgcttcaagaacaaacaaaaaatgagtgagttaaccttgctatcaaattctgataaggaaactcttaccagagcgtacatctgtgctgga
aagtagtgcacgctccccgaaggtatctcctggccccaagactactaagcgaatgaccccattaacccggcttgggtcgtttttaaccacatccactgaa
caaaacgttagtacagaggtcatgtggattaaagagcctggaaacgtacctcgaccggagtagactaggtagaagctgtctccgtcgtctccctagagaa
aaagtaaggtttttaggctcaatacgtgactgacattgcgaggggcaactgcaacaaacctcgtggaagacatacgctcccttgtcgttgtatgccacga
tctcaagagattgatacagtcgatcaagctacgaacaccatcagtcaaaatggtgtgcagcaaagctcagtaacgatagaaagtcaccttaactaaacgc
gatacaaacaaaaaagcaaaggatgcgttagatcaaaccagaatgtaatttggtagtagagcgaaatacgcacaggcgtccagattagtaaagaacccca
gcagtttggacgaagcgaacagcgatttgagctgcacatttgcgacaataaaattcagacctgagagcatcaaccaccgtacaagaagccaacgcaccac
gtggatatcctctaatgtacgcttccctgtcggcttgcgcaaaatggtccgacacacgtttacctgcggactcttttgctcgatggcacgcacgaaggcg
ccgtcgctggccatctcctccatctgcgacgccagcgacctgcgcctcgacccacgggtcacgtccgccacagccacgtcctcctcttcctccatgacag
cagcaatagtaattatgcaggttgaagacgaaaataacacttcaacatgttcgaccaatcaggcatttggttcaacaataattggttttatttagtgaat
accttgattaaagaactcaacacctaatttgatttatttttcagtatgacgagggagacctcgtgggtagatgacgccgtacagcgtctgcgtcggcact
tcaccagcgaccggtcggtctctgtgtacgaatctctcactgcacatgtcctagacgcagctacgggcggtgcgttgttcctggggggcgtttcagcggc
gcaagtggttcagaaggtgctgcgagtcggttctgcctctggatttctcctccctcaagctctaggagctgctgcagtggcttcttcctctgtcttggcg
cttcacttcgcctccatccctcgagaggtttaccaggagatcgcagagcagagtcgacgacgctccagtggatggagttggctcgtactgggggccaaga
atctacagccgcccacagcctggaaaactgcccgaaataagttccaggagcgctgggaggacctcccacaagctccttatccagtgtacatgatcatggg
actgttgtgcttcaagctgctgggaggccgcatgagtgcattggcaccctcgccttattccaacttgggggctttccatcttaaaaaggcttcactaccg
gctacagctgagtacgctacgagtgtggagagaggaattatccaggagttcggacgtctctatggctgccacacatgcggcattaaacggggcgtgcgat
accatgcagatcacatgcctcctaaattgtaggcagtgatagcagtgtccctaacttgtgccttgatgctgacttagcgtattgctttctgatgtgtagg
gtggccaaacgcactgataatcagctcttcagaaagatattgggacgacagacgagcttccgcttctacccgcagtgcgagtcgtgctccaaccagcagg
gaagtgtcgtgaagcagtggaaatccacgctgaagatgcatctgctgtccttccgagcgtatcacgcgacagggctgtggctcgtgctactctgtaccgg
tgggctctacgtcggaggctcaagcttccacgagacgtcggaggtggtggatacgtcagagacttcaggtgcattcacgtcctcagatttctcgctgctg
gtggctttacgtgagagggagcggaagttgcgtcgtgaacgaaggaaagcaagtgattccagtcaacgtgctgctcttgataaagagttggaggcggtag
gcgagtgcatgacagccatcaaagccgacatcaaacggcaggcggccaagtagttaacagcctttaacaagcttcagattggtgagtattggctttggcg
ctttgaggagtttcgagctatttccgttggtattgacagtaggactcttggacgctcgtgaagtgaacggggccatggcggcaacgaagcgagaatctgc
cgggaaatccctcctcgatcaacgtcaccggaggaaaagtggtgctcgcaaactgaatcacccacaacgaagtcaccgccaccttgtcacactgtccgag
gaagagatatcgcggagagagcagggttggaacgatcgttttactattgacccaccgcccaaatccaacaaagctttgtcacctgccaattctccgacat
acagcaccccgccaacgccgctaacgagggagtccaagattcgtaacgagcgtacacaatatggttggggaagtgtttattgtattagcctctgcttgtc
actcacagttcgttcatttaccaggcaaacgtggtggaagacgaagtcgcgaaccaaagaagccttcaagtgggaagctcattcctctgagcacttcgtc
aaagccaccttcagtacgtagcatactattggactattgaatgccagttactgattgtgcactacgtacatacaggaagcagcacaacccagcaaggaag
aaagactgcggtttaaggtcttgaaagcgattgacgcccgtgaaacgctgctgtatcagttgagcgctctaattctttgcacaccagtacaggaatctct
cttccaaccatccagacctacagagcccccaacgtcgaacattgggggccggcagcagatgcgatcgagaggagggatggcccttgcttcgaccccatta
agtcgacacggtggagcctatggtgcaatgacaaacactcgagaggctacgaaactagcacaacaactcgccacgaacctgcaggttaccgggattcagt
gcgttgaagctttggtggaatggatgctcgaggctggagcgcaggcagagtacgcgtttttatttagccatcacgccctgctgcttctaacgcgtttgct
gttgtgtcttcataggaccccacctccatttttgtggcgtggccgtaactacttcctgaagatgtttggcgacttggattttgcagaagcagaactgcag
gcgagaggagtcaatctggactgttttagacagcacaaccccctgctcatcaagccgaagcagaagttgggtcgcgtactggctgctcactctatcatca
tggaaatgatcgagtttgcgaaagatatgacgccaatggaattgttggcact