Description :
From Genome Similarity Track
Location :
Scaffold_6:207227- 212278
Transcript NameFunction/comments
Physo_128885hypothetical protein
Physo_128886hypothetical protein

Sequence
5051 bases(100 bases per row)
AGTACGGATGCTACAGAACAGGGTGATGGAATGGGTGGTGCTATTCCGGATGCTACTGATCAAGCCGACATGGGGCATCGTTTGGCCGCTAATGCCAACC
AACCGGATGCAGTGCGTCGTTCAGCTTCTCCTGCGGATACTGAGCAAGTTGATGGTGCTACTGAGGACTCTACAGACCAAGCTGGTAGGGCGGAAGCTAC
TACTCTGGATGTGACCGATCACACGGCGTCAGCACAAGTCATTACTCCGGATGCTACCGAGCAAGGTGGTGCGAATTCCGGATCCTACAGAGCAAGGTGG
TGCGACCCACGACGCTATTCCGGATCCTACTGAAGACAGATCGAGGCCGTTCGACGATGAAGAAGCCAGGAGTGAGACCGACAATCCCCCCAACCAGTGC
AAAGACTTCATCGATCTGGACGTGTTTGACAGCGACAACTTGATGGAAGGGCTGCGCAAGGAACGACTGTTTGGACCGACTGCTGAAGATGACGTGAACG
TTGTAGCGACGGCTGATTTGAGCGACTGCGAGTCCGATGCGAATGATGAGGATGTTATGACCGACAACGCCATAGCTCCAGAAGATGTAGAAGACGTAGA
CGACGTGGAAAGGAATGAAGGTGATCTCGACACTGGGACGTTTGATTTGACTGATGACGATCTTCGGACCATTGCGGAAAGACGTTGGGTAACCTACGAT
GAGGAGCACAGCGGTAAGCCGGATGGTACAGAATGTGTGGATGTACAGTTGTGTTAATTCTGTATTATCCATCTTTATGATGATTCAGGAAATCTCCAAG
TCGACGCCGCAACGGACTAATACGACGGGAAATATGGTCCCACCGGTTCTGCTATCGCCTACGCGGATTCCCCGTTGGGCATGTTCTTCTACTTTCTGCC
CAAGGAACTCTGGGTTCGTATAGCTGAAGAGACAGAGCTCTACCGACTGCAGAATATCCCGGCAATGACAATCTCTCGCCGAGAGAAGTTGCTAGCCCGA
CAGGCCAAGGATCCGCGCGTGAGTGTGCCTAACGTGGAGGATATCGAAGCAGACTTGAACAAGTTCAAGCCCATTCAAGCGCATGAGATCGTGCACGTCG
TAGCGCTACTCTTTGCTAGGGCTGTGGCGCCAATTCGGGATGGCGTAGCTCACCACTGGTGTACTGATGAGGATGGGGCTATTCCGCGCGGAACCTTCTC
ACGCTTCATGAAACGCCGCCGCTTCGAAGACATTATGAAGTTCCTGCACTTCAACAACAATGAGGACGCCGGGGCCCACGCTGACAAGGCATGGAAAATT
CGACCGGTGCTGCAAGCAGTCGAGAAAACGTTTCGTCGTGGATATCGGCTGGGGAAGTCATCTCGTTCGATGAAGGAATGATGCCGAATCGCAGCAAGTT
CAACCCCATGCGCATTTTCATGCCGGACAAGCCCAGCAAGTACGGCACGAAGTTCTACATGACGTGCTGTCCTGAAACCGCATACTGTTCTAGGTGAGTT
TTCCTGTTCTGTATTCCACTACATGTAATCCGGATCCTACAGAATAAATTAATCTGTATCTATGGAATTCTGTATGCATACAGAGTTGAGATTTACTGCG
GTGCAGACAAGACAAAGAAGAAAAAGAAGAAGGCGCCCACAGCAACATTGGGGCTGGGACCAAAGGCTGTCGTGAGGAACATCACGAAAGCGCTGATCAA
CCAACCAATGAAGCGCTTGATTGTGACGGATAGTTTCTACTCCACAGTGTCGCTGAGCTTGAAGCTGCTCCGCATGGGCTTGTATCACGTTGGCACCACG
AGAATCGATCGCTTGGGCTGGTGCCCGATCCATTTCACGCAAAGCAAACGCCCGCAGCGGATGCCAAGAGGTACCTACCGTATTGCACAAGCTCACGACT
ATCCTGAACTGGTTGCACTGAGCTGGATGGACGCTAAGCCGGTGAACATGCTCGCCACGGGGTGCAGCACCCACGTGACTAGCGTGCTGAGGACGGAGAA
AGATGGAACGCGCAGCACGATGCCTTGTCCGCAGCTGGTCGTGGACTACGGCCTTGGCATGGGAGGGGTCGATGTCCACGACCAGCTACGACTTCAGCGT
TACAGCATCCAGCGGTGCATATCCCTGCGCATGTACTACAAGCAGTTATTTCTGTGCCTCGTCGACATGGCTGTCGTCAATGGATACGTCGTGCATTGCT
GGGTGCTCAAGAAAAGAGGAGAAAAGCCACCTACCCATGCTGAGTACTTGCGCCGCTTGCACACGCAGCTTTTGGCGCTGCGGACGATCAACTTTGAGAC
CCACCCCAACGCAGAGGACCTAGTGTCTGTACCAATCCCACGTCAAGACCACACATTAGCGAACACGGACAGCTTCTACTCTACCGCGAAGCAGTACAAA
CACCGACAGTACCTGTGCAAAGTGCGCTCTACATTTGCTGACTCAAAGACGAAGTCGTTCGAGACCAGCTACTTCTGTCCGCAGTGCAGCGATGCATTCG
GAGGCCGCGTACCGCTTTGTCGTCAAGTACGACGAGGGGAGAGCGGGAACACACTGCCCTGCGCTAAGATCTGGCACGACACGTGGGGTGATGGCAACAG
CATTTCAGCGAGCCTGAGAAAGAAGATTAGATTCCGTAAGCGTAAGCGAGAACAGGAGGAAGAGACGTAAGCGTGAGGTAGCAAGGTTAGTCGTGAGCTT
TGCGTATCTTGTAACTGGGTTGCATGATGGACATCAAGGAGAAATCGCCCAGTACCTCCTCACTAATCCGTTAGTTAGGAACTGGGCGATTTCTTCCTCC
GCGCTCTCTCGCCGTGAGAGCTGCCACGTGCTCTTCCTACCAAGAATTGGGGGTCTGCGCCAAAGGTGACAAATTTAGCAACATTGGAGGGTATTTATCG
CTAACAGGTATTGCGCGTGCTCTACGCTCGCCATAGCCAATAGAAGATCGCTATTCTGACACATGTTGGATACATTGAGGATGTTATGTCCCACTTCGTA
GCTGTTTTGTCCACCAATGCGTACCGATCTTGACCTCAGGATGCGAAAGGGCTTCCAACAGCAAATCTTTGACAGGTTTGAAGTATACTTTAATCAAGTT
TAATGCTTATTCTGTAGGATACAGAATAAGAGTTGGGGTTAGAAGGGTTAAGGCGCTCGAGATTGTGTCTATGCTGGACCAATCAATGTCGTGCTCTCCA
CCGCAATCTTCCTCTCGCGTGAAGTTGGTGAAATCGAACTCCACATCCGACCTCCCACAGATGGCTAGCGTCCAAGCTAGCCTTCAGTGTGGCATCGCCA
TCGTCCACCTGGCCACGAGGCAACCCGAACAGCACCTCTTCGGGGTGATCAGAATCCAAAATGGCAGCAAACGACTCGATGTCCTCTTCACAAAGGGTTT
TAATCCGAGCAAGCGCGAGGGATTCCAACGCGGAACACGCACGCGCGCGTTTAGAGAAGAAACTGTAAGCGATCCACTCCCACCACTCCTCCGTTGACAC
TCGGTCGAGACCGGGGAAGGCTAATAACAGAGCCAGATTTTTAGTCGTCTGATTCACGACCATTGCCGAGCCCATGGCTTGAACATCCGCAGTTTCCAAC
TCGGGGTGGCCCTTCATCACCACAGTATCAATCTGCAGATTAGTGGAAGCCCCAGTATCCACCGCAGGTTCCGAGCAGTAATTAATCTCACGAGGGCGGC
GCGTGCTGTTAAACAAATTCGCCATCACCTTGCCGAAGACTTCCGTCGCCTCGCTGTCATCACCAATACGCCTGTTGCCCCACTGCGCAGTCATCTTCAC
TTCCGAGAACCGCATTCAGTTGGAAATCAGCTTGCCGAACCTCTTCGCTATCTTCGGCCACTGCGTCATTTCCTCCAAGTCGGCGATCATGGGCTTGAGT
ACAAACGTGCATCGCATCTCTCCACAAGGCACATCCTGCTTCTCCAGACGTTGCCACAGCTCCTGGATTGTCTGTTCACTGACCAGCACATTCTTCATAA
TCTTGGGCCCTCCGTCCGAGGAAATTCCATGACACGGATAGAAACACCGCACCGGAATCACCACGTCGACGCCAGGAATATCATCAACCTTTAAATTCGT
GTCCAGCGCTGCAATCTTAGCCAGCGCGTTAACGTATTCCTTCGTGGGGGTTGTACGGTGGTCGACGCCACAGAACAGGACCAGGTCGAAGCCAACATGA
TCTTCAAAGCAAGTCCTCCAGTCCTGGTCCTGGTCCAGAATCAGGTAGTACTCGGCGGGGATATCCCTCGCCCACCTGGCGTCCCATTTACTACCCCCTA
ACTTTACCCCAAAATAATTAGAGAGCAGATACTTCCAGGCTGCTTGGTCCACGTGGGCCACTGCCGCCAATAGGGCGAGCGCCTCACGGACTTTTTTGAA
CTTTGCTCTAAACTCCATCTCGCCCGACCACTCGTCCAGGCCGTACTCGTACTCGTCGCCGTTCTCGTCCTCCGTCATGCCGCAGCGCATGGGCAGCTTC
ACCTCCAGGAAATACTTTTCATCCGACCAGAACTCCCACTCGCGGTCCACGCGCTTGTACGTGATGAGGTCCTTGAGGGCGCGGCACCACGGCCGCAAGA
AGCCCCAGCGCCGATCCATCTCGGGCTTGCGCGGGGCCATTCTGTTGGATGGACATCAAAGACCTGAAGTGTACTCTGATTGGCTCGGAGTGTAAACCCC
TAGTCAGTGATAAAACAAGATATGATGTTTTAGGGGTTTAGATCGTAAAAGTCGATTGAACCCACTTTCTGAGCCCTAAAACGATTCGAGCCATTGTGTT
GTTTGCACTCATAAACTGCCACTTCTCATATTGGTTAAACTGCTACGTGGTAGCACCCTGCTACTTCGCCCAACATATAACATTGCTCCATTGGTTCATT
TTGATGCAATGTCGCGAACGACCCCGCCGGCCGAGAAGACGAAATCGCCAATCCGAAGCAAGGCTACGCAATTCTGGGAGTTGCGCTCAGAGAGTTGGAC
TCCGACAGATTCAGCTAACGCAACCACCTTCTTCCGAGTCTTGGTTACTCC