Description :
From Genome Similarity Track
Location :
contig_4:207143- 209627
Transcript NameFunction/comments
g1231.t1hypothetical protein

Sequence
2484 bases(100 bases per row)
CCAGTCGGGTCTTGCTACTTTCTTGAAAGGACTGGACAAAGCTCTCGCCGTGATATTTGCGCTTGAAATGGTGATTAAAATCGTTTCAATGGGTCTCGTC
ATGCACAAAGGAGCCTATTTACGCAATAGTTGGAACGTCATCGATGGCATCATTGTGATTTCCTCGATCATTATGCTCGTAGCGGAGTCGTCTGGGCAAG
GAAAGAACCTCAAATCTCTGCGGTCGCTACGTGGTCTCAGAACGTTTCGCCCTTTGCGAATGATTAGCCGTCGACCAGGTCTGAAGCTGGTGGTGAACGC
CTTATTCGAAGCCATTCCAGAGGTGATGAACGTATTGTTCGTCTGTATGCTCTTCTTCCTATCTTCAGCATCGTGGCGGTAAACTACCTGAAAGGAACAT
TTTATGCGTGCAGCGGGGATGTATACAGCGCGTTATCGGATGCCAAACTAAATCTTCTTGTCACTCCAGCAGCTTGGGACACACTTTCCGATCTCCAGCG
CAGTTGGTTTACGGGTACATCATGCGAAGGATTTCCTACTGACACCCTGACATCTCAATATATATGTGGGTGCTGGGGAGCTGATTGGGGTGCTGTGCTT
CCCCAAAACTTCAACAATGTTGGAGCCGCCATGCTGACATTCTTTGAGATTTCTACTACGGAAGGCTGGGCAGATGTAATGATGGCAGCAATTGATTCGA
ATGGCATCGGCATGCAGCCTATTCGCGACAACAACATGATGTGGGCTCTATTCTTCGTGCTCTTCATCATGGTTGGCAGCTTCTTCGTCGTCAACCTTTT
TGTGGGCGTTATCATCGACAACTTTAATCGCATGAAAGCTGCCTTGGGTGGAGACTTTATGCTGACACCAGAACAGAAGAAGTGGATCGAAGCACAAAAA
GCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGGCCTCCTAGAGAGAAATTCCGACGCATCCTGTTTTATCTGGTCAAGATGCAGCGCTTCGAATGGT
TCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGCTGCAAGCCTACGCCATTAATATTATAAACGAGAT
CTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGAAGACCAGTGGAACCAATTCGACTTTTTTGTGGTA
CTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATGCTGGTGCGTGTTTTTCGAGTCACACGTATTCTGC
GGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTCTCAGCAATATCACATCCATCCTGTTTTTGATGTT
GTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAGTCACGCCAACTTCCAGGATTTTGGTAATGGATTC
CTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCCTGGAACAGCTGCATGCATGACCTAGCGTCGAGTACAGCAGGCTGCGTGGATGACCCGCCCTACGATC
CAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCGCCTACGCTTTCTTCTGCACCTTCACATTGCTGGT
GACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGACGAAGAACCGTTGTTTGAGCCAGAGATTCTTGAT
GAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATGCTGCTGCTCGTGAACCTGCTTAGACCACCTCTGG
GGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCCGTGGCAACCATCTCGTCCTCCTTTCTAACACATT
TGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTGCTGCTTGCCATGACCCGGGAAATGGTCAAAGTAC
GTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGGCACCATCTCCGATATGCCAGCTGATCAGGACGTC
ACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCGCGCCGCATCCAGCGCCAAGTGGCTCAGTGGCTGC
GCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCGGCCGCCCCAGAAAGCAGCGCGACGCACGCGTTTT
CACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGGACAAAAGTCTCGTTTTCG