Description :
From Genome Similarity Track
Location :
contig_4:207142- 209626
Transcript NameFunction/comments
g1331.t1hypothetical protein

Sequence
2484 bases(100 bases per row)
TCGCGACCCCCAGTCGGGTCTTGCTACTTTCTTGAAAGGAATGGACAAAGCTCTCGCCGTGATATTTGCGCTTGAAATGGTGATTAAAATCGTTTCAATG
GGTCTCGTCATGCACAAAGGAGCCTATTTACGCAATAGTTGGAACGTCATCGATGGCATCATTGTGATTTCCTCGATCATTATGCTCGTAGCGGAGTCGT
CTGGGCAAGGAAAGAACCTCAAATCTCTGCGGTCGCTACGTGGTCTCAGAACGTTTCGCCCTTTGCGAATGATTAGCCGTCGACCAGGTCTGAAGCTGGT
GGTGAACGCCTTATTCGAAGCCATTCCAGAGGTGATGAACGTATTGTTCGTCTGTATGCTCTTCTTCCTATCTTCAGCATCGTGGCGGTAAACTACCTGA
AAGGAACATTTTATGCGTGCAGCGGGGATGTATACAGCGCGTTATCGGATGCCAAACTAAATCTTCTTGTCACTCCAGCAGCTTGGGACACACTTTCCGA
TCTCCAGCGCAGTTGGTTTACGGGTACATCATGCGAAGGATTTCCTACTGACACCCTGACATCTCAATATATATGTGGGTGCTGGGGAGCTGATTGGGGT
GCTGTGCTTCCCCAAAACTTCAACAATGTTGGAGCCGCCATGCTGACATTCTTTGAGATTTCTACTACGGAAGGCTGGGCAGATGTAATGATGGCAGCAA
TTGATTCGAATGGCATCGGCATGCAGCCTATTCGCGACAACAACATGATGTGGGCTCTATTCTTCGTGCTCTTCATCATGGTTGGCAGCTTCTTCGTCGT
CAACCTTTTTGTGGGCGTTATCATCGACAACTTTAATCGCATGAAAGCTGCCTTGGGTGGAGACTTTATGCTGACACCAGAACAGAAGAAGTGGATCGAA
GCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGACCTCCTAGAGAGAAATTCCGGCGCATCCTGTTTTATCTCGTCAAGATGCAGCGCT
TCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGCTGCAAGCCTACGCCATTAATATTAT
AAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGAAGACCAGTGGAACCAATTCGACTTT
TTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATGCTGGTGCGTGTTTTTCGAGTCACAC
GTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTCTCAGCAATATCACATCCATCCTGTT
TTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAGTCACGCCAACTTCCAGGATTTTGGT
AATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCTTGGAACAGCTGCATGCATGACCTAGCGTCGAGTACAGCAGGCTGCGTGGATGACCCGC
CCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCGCCTACGCTTTCTTCTGCACCTTCAC
ATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGACGAAGAACCGTTGTTTGAGCCAGAG
ATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATGCTGCTGCTCGTGAACCTGCTTAGAC
CACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCCGTGGCAACCATCTCGTCCTCCTTTC
TAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTGCTGCTTGCCATGACCCGGGAAATGG
TCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGGCACCATCTCCGATATGCCAGCTGAT
CAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCGCGCCGCATCCAGCGCCAAGTGGCTC
AGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCGGCCGCCCCAGAAAGCAGCGCGACGC
ACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGGACAAAAGTC