Description :
From Genome Similarity Track
Location :
contig_55:207136- 209512
Sequence
2376 bases(100 bases per row)
TTCCTCGATACTTTTGGGGCATTTGGCCCCGTACTCGTAACTGTAGTCCTCATCTCGATCGCGTGGACGACTTGGCTCGTTATACTGTCCAAAGAGCCAA
ACGCAACAGCAAACTACCTGATGGATACAAGCGCGTTCAACAACGGACAGTTTTGGTTGATCGTAGATCCCGACTACAGTCTACAAGTTCTTAGCGTGAT
CGGACTTGTGCTGGTGGATGCCTGTTATCTGCTCATTCTGATCAAGTTGATTTCACGCAGACATCGAAATCCTAACAAGGATAAAAACGAGTGGCCCGAA
CAGTTTGCTGCTTTATATGTGATCTACCAGCGCATTAACGCTGTCTGGAGAGATATCGCTGGCATTCGTGGGAGGTATCGCAAGTTTTGGGTAAAGTAAC
TATCTTGCATTGCAACGAAAACTGTACTACTGTACTAATATCGACGTTTTGTACAACAAACAGAACTTAGGCCAAAAGATAGGGGATCTTACGATGCAAA
GTATATTTCTACGCCAGCTACTCCAAGATGGATCATCCACGCTGCTCGTAATGGGTTACGCAATATTCCTCTGCGCGAACGCATGCTCCGTTGCCGCGGG
AATTGTGGTGGGCAATCAGTCTGCATTGAACGAGATCCTCGTCGATTCTCTGTGCGTCACGATCTTCTGGAAAGGGAGTGTTTGTGATACTTCTAACTCC
ATGCTCACCTACTTGTTGCGTTCTTCTAGCTTTGACATGTTTGCTGCTGTGTTGTACCCGATCCTGGTGCTATTTTACAGTGCGAACAGCTTTGACTTCG
ACCGCGAACTTTTCAGCATAAACGTAGAAGTACTTCCAGCTGGGAGCTTTGAGTGCAACGCGCGGCTTTTCGCGGATCCAGCCGAGCGCGCACTATTCAT
CACAAGCCTAAACTCGCTGAGAATCCTGACGTTCGCGGATTTAGTGCTTCGATTGAGCATGAACTTTTCGTTTTGTCTGCGCTTTATCACTGTGATTAAT
TTAATGGTGGAGACCGCACAAACGCAAAAGATAAGACAGTCTCCATGGGAAGCGCTTGCTCAACAGTTCCACCAGCAGCGTCGTGTGCCAAAACCTGTTG
CAGCGGCTTTTGTCGCGTTTGGAGCCGCCATTGTGGTTTACACTCAAAGGTCAATATCAATCTCCCAGACAGCCTGCAGCCCCTATCCAGAGTGCGTGGC
ATTCGCTTACCAGTGGGGGTCCGGTGAGCTTTGTCCGTGTCGAACATTCGTGGATGTTTATCGTACACCTCAAACGCTTAAAGAATGGGCAGAGCCCATC
GATGTTTCCGAGACGGTGAATGCTTTATCGCGAGCAGGAATGCTGCAGAATCTACAGCTTATCAATCGCGGTCTCACACGGTGGCCTGAGGGACTTCGAA
CCTGCAAAAATTTACAATACCTGTAAGTAGCACAACATCTATCATGCTAACGCAAGCTCAATACTCTGACCATCTTTATTTTCCGTGATGCAGCTCACTA
ATTTACACGGAAACCGAAGAACTCCCGGAGTGGGCAAAGGATTGGACCAATCTACAATTCCTGTAGGTGAATGCGCGGGGGTGAGTTTTATTTTTTTTAT
TTTCTCACCCGATTGAATGCACTCGTGTAATACCAGGCTCATTGAAGGTAAGCAACTCCGTCCAAGTTTGACCTATTTGCCGGTAGAACTCTTCAGCGAT
ATGCCGTATCTGCAAATGATACACATCGGCGCTCATGCAAAGCTGTTGAGCATTCCACGACTGCTAGGCGTGCCAAACCTGCAGAGTTTGACCTTAGCGG
CTCTCTACTCTGTAACCGAGATTCCATCATTCGAGAGAGTGCCTAAACTGCAGCACTTGGCGCTGCCGTATATGGAGGCGCTTCAAACCCTTCCAGATAT
GACCCCACTGCAGAATCTCATCGACTTTTCAATTTTCAGCATCACTCCTGTTTGCTGCAACGGATTCATGGGGAAATGCGATCCAGCCGACTGGTTTTGC
GTAGGTAACCCCATGATCGATGTCCCTCCTTCGGTGTGTCTTGGTGAAGGTTCACCGCGGCCTAGTGTGGCAAGTCAAGAAGTTTTCAAGAAGTTTGCTC
CAAGTCTTTGTCTGCGTTCAGGCTTTGATATCGCACGAACCGTGGATTTTCTTACGCCAAGCATGATTGAGGTTTGTGACGGAGTTTCATACCGACGCTG
TGAATATCCTCCACAGAGCGGACGGTTTGGTATCTGTATGAACAATCGCTTGCAAGTGTTGATGTGCATGGTAAACGACGACTACATTCGATTACGTCAG
GTGCAAATTCAGAGGAAAGTGGGCCCGCCGTGCGACGCCATCGAAGAAGCTTGGCTTGGGTGTGGTTAAGGTATAG