Description :
From Genome Similarity Track
Location :
contig_50:207130- 209500
Transcript NameFunction/comments
g10374.t1OWZ00383.1 hypothetical protein PHMEG_00028436 [Phytophthora megakarya
g10375.t1hypothetical protein

Sequence
2370 bases(100 bases per row)
TTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACG
ACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATC
GAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCT
GTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAA
TGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGC
CGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAAC
ATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCG
TTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGG
ACGGACTACGAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTGAGGAAGCGTAGGAGTAATTTACT
TAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCACGAAAGCTTTGGTGTAAATGAGAACTGTATTGATTGTAAATGGGGT
TTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACT
TTCTACCAGTCATATGCCTCTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAAC
CGAATGTGTAGCCCCGCTACACGTCGTCACTCTCTCCTGAGCTGAAGATCTCGTAGTCGCTGGAGTGTTCATTGGTGGCCAAGTAGTTCACGTCAACCTT
GACGCGGCGGCGCAGAACTGCCCGCGGCTCGTCCGTCTTCTGCTCCTCCTTAGTGTCCGGGTCGGAGAGTTGCCGCAGGCTGGCGGTCGCCGCATGCTCT
GGCTCGGCCGGCTGGAGCACGCTCTGCGACAGTCCGAATGCCCTGATCTCCTCTCCCTGCGAGAGCTCGACCGGCGTCGGCACGACGGCGTCCTCGTTGT
CGCTCGCCTGTCCGAAAAGTGTGTCCAGTGTGCCCTGGGTGAGCGTGACGCTCATGTTGACCTGGGACGGCCGCGCGTCGTCGTCCGAAGTGTTGGCGTC
GCGCTCGTCGTCGTCCGATGCACTCAGGTGCAGCGCTCTCTCGTTTTCTTTGATCTCATCCTGCGCGTTCTCGTTCTCATCGGTCTCGTGCTCCGTGGTA
TCGACGTGCTTGTGCTGCGCGGTATCGTCCTGCTCGTTCTCGTTGAGCAGACCCGAGGTCAGCGCATGCGCCACGACCGCCGCCTCGCCAATGAAATGGC
TGCTGCCATCAGGAGTGGTGTACGTCCAGTCGCTCGCCAGTCCGCTGGGCCGCTTTGCCGTCCAGCCAGCCGCGCGCAGTTGCCGCCACAGGTGGGGGAA
GTCGACGTCGTGGGTGGCGGCGGCGGCGGGGGCCGTTCGGCGGCTGGCACGGATGCGCACCATCGGGCAGATTCGGAAATGAGGAGATCCGGTCCACTCA
TCTTTTGGACGTGCTCGCTGTTCCCCTTCCCCTCCTCCGTCATGCCCCGTTTCTAAACGAGCGATTCTGACCTCTCCGATCTTATTTTTCAAAATGACTT
GATTAAAGTATGGCCCGAGTCATTCCCTGTCCCTGTCGTTCCAATGTTGTAACTTACGACATAACAAAAAAGATGTTGTAAGATACGACGTTGGGAATCA
GGGGGTTAACGAGACCCAACTAATCAATTCCTACTAATATAAAACAACTCCGGTGAAATCCCTGGTTCGAATCCGGGCACGCGCACCAGTTGTGACGAAG
TCGATGAAAAACATTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGG