Description :
From Genome Similarity Track
Location :
contig_50:207123- 209493
Transcript NameFunction/comments
g9912.t1hypothetical protein

Sequence
2370 bases(100 bases per row)
ACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGT
TGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACG
TAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCG
AGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGC
GGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCG
TTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGC
AACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCG
GTCGTTGGACGGACTACGAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTGAGGAAGCGTAGGAGT
AATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCACGAAAGCTTTGGTGTAAATGAGAACTGTATTGATTGTA
AATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAG
GTGTTACTTTCTACCAGTCATATGCCTCTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGG
AGGTGAACCGAATGTGTAGCCCCGCTACACGTCGTCACTCTCTCCTGAGCTGAAGATCTCGTAGTCGCTGGAGTGTTCATTGGTGGCCAAGTAGTTCACG
TCAACCTTGACGCGGCGGCGCAGAACTGCCCGCGGCTCGTCCGTCTTCTGCTCCTCCTTAGTGTCCGGGTCGGAGAGTTGCCGCAGGCTGGCGGTCGCCG
CATGCTCTGGCTCGGCCGGCTGGAGCACGCTCTGCGACAGTCCGAATGCCCTGATCTCCTCTCCCTGCGAGAGCTCGACCGGCGTCGGCACGACGGCGTC
CTCGTTGTCGCTCGCCTGTCCGAAAAGTGTGTCCAGTGTGCCCTGGGTGAGCGTGACGCTCATGTTGACCTGGGACGGCCGCGCGTCGTCGTCCGAAGTG
TTGGCGTCGCGCTCGTCGTCGTCCGATGCACTCAGGTGCAGCGCTCTCTCGTTTTCTTTGATCTCATCCTGCGCGTTCTCGTTCTCATCGGTCTCGTGCT
CCGTGGTATCGACGTGCTTGTGCTGCGCGGTATCGTCCTGCTCGTTCTCGTTGAGCAGACCCGAGGTCAGCGCATGCGCCACGACCGCCGCCTCGCCAAT
GAAATGGCTGCTGCCATCAGGAGTGGTGTACGTCCAGTCGCTCGCCAGTCCGCTGGGCCGCTTTGCCGTCCAGCCAGCCGCGCGCAGTTGCCGCCACAGG
TGGGGGAAGTCGACGTCGTGGGTGGCGGCGGGGGCGGGGGCCGTTCGGCGGCTGGCACGGATGCGCACCATCGGGCAGATTCGGAAATGAGGAGATCCGG
TCCACTCATCTTTTGGACGTGCTCGCTGTTCCCCTTCCCCTCCTCCGTCATGCCCCGTTTCTAAACGAGCGATTCTGACCTCTCCGATCTTATTTTTCAA
AATGACTTGATTAAAGTATGGCCCGAGTCATTCCCTGTCCCTGTCGTTCCAATGTTGTAACTTACGACATAACAAAAAAGATGTTGTAAGATACGACGAT
GGGAATCAGGGGGTTAACGAGACCCAACTAATCAATTCCTACTAATATAAAACAACTCCGGTGAAATCCCTGGTTCGAATCCGGGCACACGCACCAGTTG
TGACGAAGTCGATGAAAAACATTCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGGTGTAAACCCTGAACGCAGTTC
CTTGAAACCGTGATTCAGAGTGGCGTGGCACCTTGTGTATTCCCTATCGGCGTCGATTGCTTCGGGGGGA