Description :
From Genome Similarity Track
Location :
Scaffold_129:20711- 21839
Transcript NameFunction/comments
Phyci_286808NEDD4-like ubiquitin ligase, putative

Sequence
1128 bases(100 bases per row)
CGGCAACTCGAGCATGTTGTGGCACGCGTGGCTCCGGAAGTAGCTCACATCGCCTGCGTCTGTTAGTGTGAACTTGCATAGCTGGCCGTCGTAGCTCGTA
AGGCCTTGGAAACCCACGAGCGGGACGCGCGAACAGCCTGTGGCGAACTGCAGCAGCCGCTTCTGGTACACACCCGACATCTCCTGCACGACGTCCCAGA
ACCACGTTACCTCTTGCCGGGACTCCAGCGCCACGTGCGTGTGCGTGTGGTGCTTCCAGTCGGATACGTCGATATCGTCCGAGCCACACAACAAGTAGTC
CAGCTCCTCGTAGTCGAAAGGCAGTAGCATGCGCTGAGGCACCACTTCGTAGAAACCCTTGAGGAAAGACGCTAGCTGCGGCGCCACGCTCTCGAACATC
AAGAAGCGGAACTTCCGGTCCGCAAACTCGAACTTGTTGTCGTCGTTCACTTGGATGTTTCGCCCAGCGGGAATGAGCTCTACCGTTTGAGTGTGGCTGC
CGTGACGCTGTGTCACCGTGAAATCCAGCTCCAGCGACTCCGTGTTGCCATCCTCGTTGTCGAGTAACCACGTCAAACTCCGGTACATCTCGGCGTCCAA
GTATTCGAGGTCGCCGAAAGTGATCGGAGTCCCCAGCATCATCTTCAGCAGCGGTGCACACAGGTGAAAGTTCAGCACGGCTCCTTCAAGCAGAGCGCGT
CCAACCAACCGACCAGCAGCGCGAAAATGCTGCAAATGGTTAGCGCCCAGCACACGCTTCGACTGCGGGTTAATAAAATACGTCTGGTCGCTGCGTTGCG
TGCAGGAGAATAGCCCGACCTCAGGGTCCACGAGCTTCTCGTTCAGCAGGGTCAGCCACTCGCGGTGCAGTCCTCTCACACTCTTCTCATCACCAGACGA
CTCTTCCTCTCCAGCAAAATTGACTTCGAGGCGCACGGAGCGGATGCTCGCCTCGCGGATGCAGTTGATATGCTGCACGGACTGCTCCAGGATATAGTCA
CGGTGCACTGACAAGCACGATCGCAGGCTCCGGTCGCCCGCTTGAAGCAGCGTCGTCGCACTAGCAATGAAGTGTGCGTACTTGGTCGGGAAATCCTGGG
CAGCGGCGTCCACCGCCATCTGCGTCAG