Description :
From Genome Similarity Track
Location :
Scaffold_441:2071- 3074
Transcript NameFunction/comments
g17854.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GCATCCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATC
GGAAAGTGCATGTTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGC
TTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGGCGCTGGACAAAGTCCATTGCATTCGAGCTGAACCCCTGGT
TCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTCCGTTGTGGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCC
ATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCA
CTTAAGGAAGGAGCTACCGCACCGAGTATGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGT
TGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGTTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTC
TGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATTGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAGCGCGGAT
CCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATATCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGC
AGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATG
GAC