Description :
From Genome Similarity Track
Location :
Scaffold_493:2071- 3073
Transcript NameFunction/comments
g17180.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
GCTTCAGTGGCTATTCATGCACATCGATACAAGGATGATTCGGTACTTCTCGTACGGAAACTGCGCGGTGGGACCACGAACCTCCTCGTACGTTGCCTCC
ATGCTGTCCTTTTTTAACTTGTAGGTGCTAAGAATAGGCCCAAATAACTGGCAATCGAAATTGAAGGTTGAGTCGTTGCTGGTGATGCGCTCTCGAATAA
AATACGAGACCACAGTATCATCAAGCAAACCGTTCAGGTCCAGCGTCTTCAAATTGTTTTTCGTAACCTCAAGACGTAGCGTGTTTGTCTCGGGCTGGAA
GGATACAGCCAGAGCACAACATACCAGAGCGCTATCCAACATATTGTGGACAGGATCTGCTGCAGTCATTTATTCTCCTTCATCAATCTCCACAGGGAAA
TTCTTACACCCAATATTTTTACCCACCGATGTCTTTTCGGGTAAACCCGACACCTTGGCCTGGGTCTTATCAGGTAAACTTGACATAAGTTTGAGTCGTT
TTAGTGCGTTCTTGGTCGGGTCTGACGTTAGTTCTTTTGGCTTCTTAAGATATCGCAAACATAGTTCTTGGGGTGGTTGTGGCAAATAAACCTGGTTAGC
CACGACTCCTTAGCACCATTTTTTTGTCAGGAAACTCTGGATTCACACGGACATGCTGTAGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAA
CATGCACTAATGGATACATTCAGGTTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAGGCATATGACTGGTAGAAAGTAACATCTTTCTACCAATG
AGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACTGATGGAAGGTATAGATCTTGACACCGTGAAGCTTGACGGAGCGGAGGGAGG
GCAGCACTCTGGGCGAGACCGGAGCGGAGACAGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGATAGCCTT
CT