Description :
From Genome Similarity Track
Location :
contig_75:20709- 22295
Transcript NameFunction/comments
g12325.t1hypothetical protein

Sequence
1586 bases(100 bases per row)
TACACTCCTGGCCAAATTAATCCGGCCACCCACCTATTTGACCGTAGCTCAGCCAATTCTACAGATATGGCCCTGCGGTTTTGATATGTGTTTTGTATAG
TACAGAGAAGCACAGTGTTTGTGTTAACAATTGCGGTTTTGCGGTTTGTGCGGTAGCTCCCATACAATACACCGTTTTGGGTATGCGGTCCAAACTTCCG
GCCACCCGACCCCATACTAAAATGAAGATATATGTAACGAAAAGATTGTATTAGTAATGCGTTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTC
GAGGCATTGAATCTATGAGCGTCGTTAGCGTAGCTTGATCAATGTTTTTCCACGCCGTCAATATAGCTGCTGTCAGGTCTCCAACATTAGCGTACTGGCG
TCCGTTGGGGTAGACTTTGCGAGCCAGCAACGCCCACAGGTTCTCGATGGGGTTCAGGTCGGGTGAACGGGCAGGCCAATCGAGCACGTTCACTCCTTGC
TCTTCAGAGAACGCCTTTGTCTTCTGCGACATGTTAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCTTAGTTTAGGCGAGCATAGGGTAGCA
AGAACTCCGACACAGTGTAGATATACTGTGCCGAAGCCTGCCTCCCTATGAGCACCACGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCAT
CACAGAGTCTCTACCGTTCTGACGCCTCACTGTTGTCCTTGGCGGCCGCCTCACGTCGTGCCAGTAGATTTGGAGGCCGTCGGGCCCGTCCAAGTTGAAC
TTCTTTTCATCTGAAAAGATGATGCGCAGCCAGTCCTTCTTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGGTGGACCTTGTGCGCGGCTGTCA
GTGCCAGCGTGTTCTCCATCTTGATGTAGATTAGGCAGTCTACACCAGCAAGGAGACGCCGTATCGTGCGGGGTGAGCACTTGCAGCTGCACTCTTCTTT
CAGCTGCGCGGCCGTGTAATCGCCGCTGGCCGCCTTGCGAAGCAGCAAACGGTCAAGCCTCTCTGACACAACGGGCTTCTTTCCGGGTCGGCGGCGATTT
CGGCGTGGCGCAGCAAGGGCTCGTTCAACTGCGTCGCGTGAGCACTTGACTCTTCTTGCAATAGCCCGGACCGAGAGCCCTCCTTCGTGTAGTCCTCGAA
TGCGTCCTCTTTCCTCGTCGCTTAGCCAAGGCGACATCGCCCAGTGAGTCTGGAAATGAAGCGACTGAGGTGGAGACCTGCGCAGTATTAAGGGTGGACA
GCAGATCAAGCCAAATGTTTAATCTTTTCGTTACATATATCTTCATTTTAGTATGGGGTCGGGTGGCCGGAAGTTTGGACCGCATACCCAAAACGGTGTA
TTGTATGGGAGCTACCGCACAAACCGCAAAACCGCAATTGTTAACACAAACACTGTGCTTCTCGTACTATACAAAACACATATCAAAACCGCAGGGCCAT
ATCTGTAGAATTGGCTGAGCTACGGTCAAATAGGTGGGTGGCCGGATTAATTTGGCCAGGAGTGTACCACTCCGTTCCGTTATTAT