Description :
From Genome Similarity Track
Location :
scaffold_5:2070898- 2072109
Transcript NameFunction/comments
Plaha_PHALS_14368hypothetical protein

Sequence
1211 bases(100 bases per row)
GTATGTGTATGGTGAGATAAACAACCAAAGATTTTAATGACATCAAATTCATATTTATACTATACCAAACATCATATTTTAAGCACATGTCTAGAAAGTT
TGATCTAATCAAGCTCCGAGATGGAAGAAGACCTGCAATCAAAAGGCATAGCTTGTTGATATCGATATTGCGTATTAGCGTTCATTTGACTCGTAAACTG
GTACACAGATTCTGATTTCATCTGCAATTGTTGCATTCTCCGAATCAAATCTGCTTGGGAGCAATCCACATACACTGGATCTTCACTTGCATACTGTGGT
TGATGTTGTAGTCGAGATCGATACGTAGTCACTTCAAAACACGACTCATCGAAATTGCTGTCCCGATCTTGTTGAGATGGAATTGTCGAGGCAAAGGATG
ACTCGAGATCGAAACCGTTTGATGTTTCCAAAATAGTTGTCGAACTCTTTTCTATCCTACATGCCATCGCTTCAGGTTTCACAGTGTCAATGAGCTGTAC
TGCCGAACAGCTTCTTGAAACATTAGTACCGGTTGCTCCAAGCTCTACGAATCGATCACATCTTCGAACATTTACGTTATCGGTGGTACCCAGAGTCCCA
ATATATTTTCCGAAATCGATATTTTCAGCTTTGGACGATGATGACGTTGGCTTAGTCCGTTGATCCATGGTCAAAATACTTTCTTCTTTAGTCGACATTG
TTTCATTCAGACTATATCCCGCTTCTACGTCCCGACGCGCCATGTTACGAGCATCCATATGACTAGCGTTCATCTTGCAGTTCTTACATAATGTGGCCGG
TAGACACTGAACTTGACCATTAACATATTGGTTTTCGCTTCCGATCTTGCTTTGAGTGATGCTATGTGATGAATAATTGCGTCTGATCATACCGAGGTCA
TGACTGACACGACACCGTGAACAGACATTAATGAGACACAGATCGCACGACGCCACGCTGGTCAGAACATTAAATTTGCGATCGCAAATTCCACAGCGTT
TCAAGGAACGCTTAGAATCTAGATGTCTTTGACGAAAGTCTTGCGCAGCATTTAAGAAGTTAAGCAGCCAGCTTAGTTTTTTGTTTTGACCGCATGTTGT
TGCCTCTGTGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN