Description :
From Genome Similarity Track
Location :
Scaffold_789:207- 2261
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_789-abinit-gene-0.8Protein kinase domain containing protein

Sequence
2054 bases(100 bases per row)
TCGCTGGCTACGAGACGCTGTCGCTGCTGGGCAGCGGACAGTTCGGCGACGTGTTTCTCGTCAGGCGCGTGCGCGACAGCCAGTTGTTCGCAGCCAAAGT
GCCCAACCACATGTGCGTCGGTGGAGGCAATGCAGCGGCGGCGCAGGCCAAGCGCGAGGCGGAGCTGCTCAAGCGCATGCGCCACGTCAACATCACGCAG
TGCGTCGAGACCGTGGAGGATGCGCGCAGTGGACAACTGGTGATCATCATGGAGTACGCCAGCGGGGGCGACCTGGACGACTACCTGCGCTCGTATCAGG
ACAGGTATTGGGCTGGCTATCTGCTTATATAGGGCTAGACCATTCAGCCTTGTTGACAGGACTCTTGTGATGATAAACAACAGACAGAGCATGATAGGCG
AGGCTGAGATCATGCGTGTCTTCATCCAGATCGCGCTCGCGCTCGAGTACCTTCACAGCCACCGGATCCTGCACAGGTAGCCCAATCGATAGAGATGCCT
TGCCATACACCACGTGAACTTTGACTGAATTCTGTGAACGTTGTCTGTCCTTGTTAGGGATCTCAAGCCAAAGGTTCGTTGCGCAAACAAGCTGGTGATA
CTAGTTGAGAGCTGAGCTGTGTGCTTGGTGCTGCTGCTACAGAACATCCTGCTAGACGCGAACGGAGTCGTGAAAGTGAGCGACTTTGGTGTCTCGCGCT
CGCTGCAAAGCTCGCTCGACGCCGCCCAGACAGTCACCGGCACGCCCAACTATATGTGCGTCCCATTACAGTATACTACTACAAGCCGACCTACAGGTAC
TCTTGGTGACTCACAGTGTTGCTATCTATCTGCCAGGTCGCCCGAACTCATGGACGATCAGCCGTACGGCGCCAAGAGCGACATCTGGAGCCTCGGCTGC
GTGGTCTACGAGCTCGCGAGCTTCGCGCCGCCGTTCAACGGCAAAGCCTTGGGCGCAGTCGTGTACCAGATCCTAAATGCAGAGCCCGCATCCTTGGCGT
CCTGCTACTCTAGAGGGTTTCAGGACCTGGTCAAGACGCTGCTCACAAAGGACCCACGGGTGAGTTGTGAACTTGTGCTGCTACTGTATCAGATGGCTAT
TGACGCTCTCTCTCTCTTTGTAGACTCGTCCTGATATACGAGACGTCCTGCGAAGCGAATTTGTGCTCAGTCACATGTTTCAGGTCGTGAGTGTTGCCAC
TTTCCAGCAGCCAAAGAGCCTTGAACGATTCGCTGCGGGGCTCAGCACTGAGCAACCAACAGTTCAGTATCAGCAACAACCATTAGCACCAGCGGTTGTG
GTGCCGAGCGAGTGGTTTCAGCCTTCGCATGCCCGCCAAGAGCACAGAGTTCAGCATCAGCAAGCTCATTATCAGTATCAGCCAAGGCCCCAGTACCAGC
CTCCACAGCAGAAGCCGCAGCCTCAGGGTGACGATGTGGCCCGGCAGATCTTCTTTGAGAACCAGGTTCGCAAATAACTCGAATATCCACATAGTCACCC
TCTCGAAGAACAACTCATTCACCTCCATCAACACAGGCTGCTGCTCGGAGGAACAAGGAGCGCGTGGACAAGGATAAGAGCGCACTAGCAGTGTTCATGG
AGGAATCAGAAGTTGGCATCAGAGCCCAGCAGCACCAGCCAAAGCAGCAACTGATGCAGGACCAGCAGGCTGCAAACGACCACGCCCGACAGTGTTTCTT
GGAGAACGCGCGCATCGCAAAAAACAACAAGCAGCGAGCGCTCGATGCGATGAGAGAAGGATCTGAATTCCTTCCAGCAGCTCCACCAATGCAACCAGGT
AATGCTCGGGCAGTAACGAACTGCGAGCAAACTCTGTCACCTCCAGTGCCTCCTGTCAGCCAGCGTGCTGCTGCCCGCAAAGAACGCAACAGTGCGTACG
TCGTGTGAAGTTGATATCATTGGCCTAGGCTAGCCGAAGCTGACCGTTGTACATTCGCGCGACCAGGTCTAGCTACGAGGAGATGCTCGAAGCGGAGCGC
AGACGCGTACGGCTGGAGACCAAGGCGCTCCACCAACGTATGCGCGCGATCCAG