Description :
From Genome Similarity Track
Location :
Scaffold_223:207- 1733
Transcript NameFunction/comments
g11670.t1hypothetical protein
g11671.t1KUF77474.1 hypothetical protein AM587_10012592 [Phytophthora nicotianae

Sequence
1526 bases(100 bases per row)
CAGTCACACTAACCTCATTATTTCCGGGTCCAGCATATTCTCCGGACCTGCCGATTCGATGGTCTGCTGCCACGTATTAGTTGAGCCCGGGATCACGTAG
CCGAAGTTGAAAATCCACTCTTTGATGAGCAAAACACGCAGGACGAGTACGTTAGTTCTCGGTACCATGCCATTCATACAAGTGAAGGTGATTCACCTTC
GATGCAGCTTCCATCCAGGAAGACACGCTGCTCCAAACGAAAGCGAGAAATCTCCTCAGCTGAGCTGAAGTTGATCTCTCGTGACACAGCAGAGCACTTG
AGAATATCCACCGGAAGTCGCGCTACTCAAAATTACCATGGATAAGCACTGAGTCGGATTTGAATACGAATGAAAACGAATTACCTTTCTGCTCGACACG
GTAGATGTCCTCACCCCTGTTCAATACAGTTAGAGCCCTGAATCACTTGGGAGTCTCAAACGGTTTGCACGCACCATTCGTCCGACTGCCACATCAGTCG
ACCCGTGTCGGCACAGCGCATATTCATGTGGTTGCTAGTAATAACCAACCCACCGTTAGTGATGACCATCTTCCCATTTACCATTGCAAACAGTTTGCTG
AATGGCACGTCGTCTCACATGGTAAGCCCCTTGCAGACAGTCTTGGCCCAGGAGCTGTTGGCAATCTCAATCTTCCCGGTGCCGCCGTCGTGCAGCTGCT
TCCACTCACGCTCAACCTCGAGATCCAGCTTGGCTTGAGCTGCGCGGGACTCGTCGTCTTTGACCGGCTTTGCCTCCTTGTCCTTGAGCCGTGATTGCTT
GTCACTCAGCTTCACGTTGCTGATCTTGCACCCGAGCTCCTCGTCATGGTCAAAGTGCTTCGGCTCCATATGCAGAGCTTCCTTAAGAATGGGCGTTATC
TTGAATGGACAGACTGCACTGGGACCGACCTTTTGGAGCGGGCAAGGAATTCAGCGGCTGAAACGCCATGCGAACAAGCGTATACGCAGTGTACAGCAGA
ATAACTGCTCTCGGTCGCTGAGGCTTGAGTCGGTCATGAGGCGTTCAAGGCGGAACGAAGGTGAGCAGCGGCTGTGGCTTGCTCAGTTCACAGCGAATTG
CTCAGTCCAACGTGTCCTGATTGCAGCCTCTTTTCAGTTTGCTAAGTCTGACAAGGCCACGATTATCAACGCTGCGGCGCTGCAGGTAGAGTAGCGCTGG
GACCACCATTTTTACGGCACTCCAGTAATGACGGACATTTTCAGGATCACCTGGCACGTTCCATCACTTTGGACTTGCACCTTCGTCCAAGAAGACCTCG
CATTCCTCGTAAGCCAGCCGTACGTACCGCTTCAACGTCGCTTGTTCACATGAAAGCGATTTCATAATGATCAGTTCGGTTGACAACTGCAGATTGGCAG
CAACGAGAGCGCGGTTGCTAAGAATGTGTCAACGTCAGAGTATCGCTGCGTGTGGGTCTGTGAGACTTGTACTTTTGAAAACGATGAGCGACCACACTCC
AGAAGTGATGGGCCTGAGTCTGATCG