Description :
From Genome Similarity Track
Location :
contig_75:20697- 22283
Transcript NameFunction/comments
g11775.t1XP_009534708.1 hypothetical protein PHYSODRAFT_361865 [Phytophthora sojae

Sequence
1586 bases(100 bases per row)
TACACTCCTGGCCAAATTAATCCGGCCACCCACCTATTTGACCGTAGCTCAGCCAATTCTACAGATATGGCCCTGCGGTTTTGATATGTGTTTTGTATAG
TACAGAGAAGCACAGTGTTTGTGTTAACAATTGCGGTTTTGCGGTTTGTGCGGTAGCTCCCATACAATACACCGTTTTGGGTATGCGGTCCAAACTTCCG
GCCACCCGACCCCATACTAAAATGAAGATATATGTAACGAAAAGATTGTATTAGTAATGCGTTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTC
GAGGCATTGAATCTATGAGCGTCGTTAGCGTAGCTTGATCAATGTTTTTCCACGCCGTCAATATAGCTGCTGTCAGGTCTCCAACATTAGCGTACTGGCG
TCCGTTGGGGTAGACTTTGCGAGCCAGCAACGCCCACAGGTTCTCGATGGGATTCAGGTCGGGTGAACGGGCAGGCCAATCGAGCACGTTCACTCCTTGC
TCTTCAGAGAACGCCTTTGTCTTCTGCGACATGTTAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCTTAGTTTAGGCGAGCATAGGGTAGCA
AGAACTCCGACACAGTGTAGATATACTGTGCCGAAGCCTGCCTCCCTATGAGCACCACGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCAT
CACAGAGTCTCTACCGTTCTGACGCCTCACTGTTGTCCTTGGCGGCCGTCTCACGTCGTGCCAGTAGCTTTGGAGGCCGTCGGGCCCGTCCAAGTTGAAC
TTCTTTTCATCTGAAAAGATGATGCGCAGCCAGTCCTTCTTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGGTGGACCTTGTGCGCGGCTGTCA
GTGCCAGCGTGTTCTCCATCTTGATGTAGATTAGGCAGTCTACACCAGCAAGGAGACGCCGTATCGTGCGGGGTGAGCACTTGCAGCTGCACTCTTCTTT
CAGCTGCGCGGCCGTGTAATCGCCGCTGGCCGCCTTGCGAAGCAGCAAACGGTCAAGCCTCTCTGACACAACGGGCTTCTTTCCGGGTCGGCGGCGATTT
CGGCGTGGCGCAGCAAGGGCTCGTTCAACTGCGTCGCGTGAGCACTTGACTCTTCTTGCAATAGCCCGGACCGAGAGCCCTCCTTCGTGTAGTCCTCGAA
TGCGTCCTCTTTCCTCGTCGCTTAGCCAAGGCGACATCGCCCAGTGAGTCTGGAAATGAAGCGACTGAGGTGGAGACCTGCGCAGTATTAAGGGTGGACA
GCAGATCAAGCCAAATGTTTAATCTTTTCGTTACATATATCTTCATTTTAGTATGGGGTCGGGTGGCCGGAAGTTTGGACCGCATACCCAAAACGGTGTA
TTGTATGGGAGCTACCGCACAAACCGCAAAACCGCAATTGTTAACACAAACACTGTGCTTCTCGTACTATACAAAACACATATCAAAACCGCAGGGCCAT
ATCTGTAGAATTGGCTGAGCTACGGTCAAATAGGTGGGTGGCCGGATTGATTTGGCCAGGAGTGTACCACTCCGTTCCGTTATTAT