Description :
From Genome Similarity Track
Location :
Scaffold_30:206939- 210745
Transcript NameFunction/comments
Phyra_97224PrAvh29

Sequence
3806 bases(100 bases per row)
ATGGTACTTTGCAGAATAAGATTTGAGATGCGATCAGTGCGATTTTGCGAAATCATATATACGCTGTAAATTACATGATCGGTATAGAAAGGAAAGATAC
ACAATATAGACAGTTTTATTTGCTGAATATAATATCCTACTTAAAGTGATACATGCTTGTGTCCCAACCTTAATCAATTAGAAGCTTCTAGAAGCTTCAT
ATACCACTGTTTATTCTGATTTTCACTATACTTGTAAAATACCTGTAAATTACCAATAGTTTTCCTTCACTGCTATTTCCATAACACTCACCCTTCTTCC
CCCCCAGTTCATACCTTGATCAGCAAACCCTGCATGAAATCAGCTCGCTCCTGACTGGGATTCGCTTAAACCAAGGCTATCTTAGCCTTCGGGCCTGGCT
GCATTAGGTTCGAGTAGGTTCCAACTAGGAGCGGCCACCATGGCTTCAACGACAGATTTTGCTGCTGCTACAGCTGCTGTGGCGTCGCAGGCAACGTTTG
TTGACTATCTCACCTCGTCGGAGTCGTCTGCATCGGACGTCGGTGGCACACGTGACGGAATGGCGGTGCAGGAGAAGGCGACACGACTAGCAATGGTGCA
GGCAAGGGCGATGCGATGGGTTGTGAGGATGCCGTGGCCATCCGACATGCCCTCGGAGTCGGTAAAATGTGAGTCTGAATTTGATTCGGTCCTTTCACGT
TCGCTGCATCCGGTGTTTATAAGTGAATCAACCTCGAGGCTCTTCGATGATGATAGTGAAAATGATGATGACGTCGGCCCCGTACGAAATATTCGTCGTA
GAAAGCGGCTAAGGTGGACGCGGTGGTAAGCGTGCTGCCATCATGTTGCTGCTGAAGATGCCGGCCAAGGTGGATGCGTTGTTAGCCTGTTGTCGCAGTA
TAAGACGACCAAGAATAAAAACGATGAGGACATAATGAGAACGTATTGTAAAAAACATCAATAAATCTTCAGTATGTCAATCGAGTGTATTCATTAACCA
TGATGATGGCGCTATTTACTTAGGTTCACAACGCTAAGTACTTAAAACCCGAGGTCCTTGCCATAGGTTCCCTTCCACCACTTGGAGTACTCCATCCAGA
AGTGGTAATTCATATCTTTGTCCAACTGAGCTGCCGACATCGTCTTGACTTTCTCCGAGATGCCCAGCTTTTCGTGCAATTGATACGGGTTTCCAACCAT
CTTCGAGACTTGTTTGAACAGCTCTTTGTTATAATCCATCATATGGTGTGCCTGGGTCTTGAGAGTTTCCACTTCGTCAAGAAGGGACTTCAAGCTCGAC
GACTTGGTCAACTTCGCGGCAACTTCAGTTATCCCAGCTCTCTCTTCGTCATCAGAGTTATCCTCTAGGTCGGCATCGACAGTCTCTCGGATTCTCAGCG
ACCTGCTGTCCATGTCGTTCTGGGCAAAATCGTTCGAGTTCAGGGTGTTCGGCGTAGCCACGGATGATTCAACCGTTATAGGGTTGGCCAGGAGAGTGGC
GGCAGCAGCGAGAAGGAAGACGCTCAAACGCATGGTCAATCGTGGTTGGATGAAGGGGTTTGAGCCTTGAGCAGCAAAAGACGAACTGATCGTAGTTGTG
GCAGCATGCACTGAGATGCCGCTGCCTGCCAGCAATGGACTAACAGATCTCCCATTATATCATAGAAATGGTTTAAGAAATATTGGTACCGTCCAGCACT
GAATCCTCGATGATCGCGAAGTTGTTGTAACGTTATGTTTTTAGGGATGGGGACATAAACCTCGTTGACGTTAAAAAAAGAGTGGTTCCCGTTCCCGTAC
AAAACTTCCCGTTAGCGTTTTTTATTCATATGTAAGCTCCCGTTCAGTGAAAAATAAGTCTCCAACCACCGGTGAGAGCGCTTTTGCCGAGAAGGTGTCG
CTCAAGAAGGTGGACGTGCTCGAGTTGCTGGGCGCTTAGATTGCCCGTGCATCTGTATATGCTTCGCCCGAGGCGCGCGTTGGTGTGGTAATCACCACAT
CAAGAAGTCCCCCAGCGCCCGTATCCCCATCGAGTATCCCCACCCACGCCTCACACACACGACGGCACAGTCATGGATGCCCAGTGGACACTGTCACGGT
TGGCATTGGCGCTGGCATCGCCGACACACTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATAGATTACGGTCAC
TTCGCTGGTTCAGTTGGCGAAAGCTGCTGTCGTTGATGCGACAGACTGGGAGCCCGTTGCCTTGGGCAACTTGTTTGGCGATGTCATCACGGGCTTCAAA
CCACTTGTGCAGTTGCCGCTTCTTCCGCTTTTGGGCTTCAAACCACTTGTGCAGTTGCCGCTTCTTCCGCTTTTGGGCTTCCGCTTGGAGAGAGGGATAG
AAGCGTGTTACTGCTGCTGCCATGCACTTCTGCTCGACGAAGCTATTAATAATATACTTGCGATGGTAGCTGATAGCAGTGCGAAGGCACTGGCTTGGCG
AAGCCTCGAAGCTTTTCACGCGTGGGCGGCTTCCTCGGGGCATTCTTGCAGACTGAGTAATGGCGAAGTGCAGTGCTGATGAATGGCTAGCTCGCTGCGT
AACCTATCGACTGGTGGTAATTTATCTCCGGGGTGCCATTCGATATGTCATGATAGATGATCAAAATGGATTAATCTGATAGGTTGATATTTTTTAACCT
TCGCCTGCAAGGGGTGCCTTTCGATAAGAGTTTTGCGGTACATGTAAGGCATAGAATACTGCCACAACATGAGAAACGGATGTCATCTCGCTGCAAATCA
CAAAAATCGGAGATGCCGACAAGAAATCTACACCTCAACCCCCCTGGGAGCGCGGTGACAGAACCCTAAGCCGAGCAATGTGACCATGCTTGATCCTGGG
TTTAAGCCCGCGTACTACGCACACGGATCTTAAACCGCAGGCGTTGTTTCGGTTTGCCGAGCGAGTTGGCGTTCACCCCCTCCTGGTATTGTTGATAGAA
AAAAAAAAAAAATAGGCTACATACAAAACTAAGTGATTCACCTTGTGGCACGATTCACTCTCATACATGTAATACGTGTTCTGTAATGCGTCGCCGACGA
TCCCGTAGCTGAAGGTATCAGCAGTGCTGATACCGCAAAACAAAATAGAGTCTGCTGTTGCCTCATAAGCAAGGGTTTGAGTTCCAGCCAGGGGTGTATT
TTTAATGTCAAATTATCCGGGTACTTGGTACCCAAATTCTCTGCACAGGAATCTCGTATAGATCTGTTTAAACAACGTATGGGCTGGGTACAGTAGACCA
GCTACTGTGCACTTCCTGCATCACGTACTAAAAAAAACTCATGAAAAAAACATTGTGCACTACACGATGGATGCCATACCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTACCCTCGAAGGAGTTGAAGGCGTGGCTGTGCTTCTGTGTAAAGGTGTGGTATCTTTCTGTGCTGA
TTGAAGTTCCAAACCTGGAGCTGTCGACGCCAATAGCTGCTCAACTGGTTGGGATGGCCGGCATCACGAAGTAAGTGACAAGAACGAGTAGTGGAGAAGG
ACGATGCATTCAACAAGTAAAGGCTAAAAGCAACAAAGATATGCCGAGCATCCATGGCGTAATTCCTGGCTCCTTGAATTATCCACCTGATGCCATTGTT
GAGATTGACGTTGTCGAAAGCCTCCTTGGCTTGGTCGAACGACACCGTCCTGGAGACCAGTTCCGTTATTAGCGATCACGTCGAGCGTGGGCCGGCTGAG
TAGCGG