Description :
From Genome Similarity Track
Location :
Scaffold_536:20693- 22334
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_536-abinit-gene-0.27GTP-dependent nucleic acid-binding protein engD

Sequence
1641 bases(100 bases per row)
AATGGCTCATCACCACCACGCTCCTTGATGAACTCGGCGATCTTTGGAAGGTACTTGTTGCCCTTGCGGAGGTAGTCCTTCTTGCTCACGTTCACAAGGA
ACACCACCGGCTTAGCGGTCAGCAGCTGCAGCTGGTTAAGCACGTCCACCTCAAGGGCATTCCACTGACCAAAGGaCACATCCTTGCCAGCCTCAAGCCA
CTGCTGTACACGGACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGCAGCACCCTTGACGAGACCAGCAATAT
CCGTGATGGTCATCACTGGAGGcaCACTACACATAGATTTGTGTCAGTGTCAACTCGCCTCCTTTGCAGCCAAGTTGCCAATACGCACGTGTTTTGtGGC
TTGACcTTctCGACCAGCCAGTTGAAACGCTGGTCCGGCACCGGCACGACAGCCTCGTTGGGCTCAAtcGTACAGAACGGGAAGTTCTCCGCAGGGATGT
TCATCTTCGACAGACAGTTGAagAaCGTACTCTTGCCAACaTTCGGCAGACCGACGATACCGATCTTGACATTGTTACCTGGACGACCAAGGTACACCTT
TGGTGGCGCTTCCTGTCGATTAGAGAAGCGTAAAGAGTACGCAGATTGGGCGCATTCGTTAGTTTGATGGTTCGCTGTAGAAGAAGCCCATCAATTGGGG
GAGCAGCCCGAAGGAGGTGGACGTACTTCCTTCTTCTTTGGCGGCATATTGCTGGTGGCGACTGATTATCCCAATGAGGATTGCTATGACTGGTCCTGCT
TGGAGATTTGGGAGCAGAAACCGGTCTAGATACCGGTTGACAGCTGGTGTTAACTTAACTGAATCGCTCTTGATTCAGTAGTCCGCTAAATTAACCTATT
CCATTATGAAACGGCAAGATCCCGCTTACGTGTTAAACTTGAAAAAATACAGTCACCGTCCTGCACTTCGTATTTCTTGCCCTGTTGcTTCAACTTGCCG
GCCTTCTTGACTGCTTCCTCTGATCCAACTACGTACAAATATCAACAACATTAATGACTACTCCAGCACAGAATCATCAAACCTCGTGCACTTACGCTCT
TTCAGGTCGGCGAAGGCCTGGACTTCAGCCATGATGAAACCACGCTCAAAGTctGAGTGGATCACACCGGCAGCCTGTGGTGCCAGACGACCCTTACGGA
TGGTCCAGCCACGCACTTCCACCTTACCAAaGGTAAAGAAGTGGATCAAGCCAAGCGCATGGTATCCCATCTTAAGGACACGGTTCAGAGTTGACTTGTG
CGTTGGGTTCTCCTTCAGGTACGTCTCCAGCTGACCAGAGG