Description :
From Genome Similarity Track
Location :
Scaffold_21:206901- 210009
Sequence
3108 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCCCTCAGCAATTCCAGAGATTCGGCGAGAAAGAAGACTCTGTTCTGTTTTCTCTTTACTCGATGCTCAATCCACTCAGACAGA
CTATGACTGAGTCGGATTCGACTTCCTCCTGTAAACCAAGGCAAGGAAATTAACTCAGCAAACCCAGTCATGTGGCGCCGCGGTCAAACAGACAACGGGA
GATTGCGCTTCAACTCGCGAACACCTACCAAGTGGACGCAAAAGCTCGACGAGCAAAAGAGAACAACGAACAACTCAGCCCAGCCAAACGACGAAAGGTT
CCAAGAACAGACCGACCTGAAACCACTACGGAGACAGATCGACAGGACGAAGAAGTGGATACACCAAACGATACTGGGTTCGGGGAAGGAGATTAAGTGT
GGTTGTTTATGGAGAAGGTGAAGCTAGGATTAAGGAAAACGTTAGCTCACCGATGGCATGTCCCTTTCCGGATCAAGAGACGATAGGAAGACTTCGATTT
AGCTCACCGATGGCATGTCCCTTTCCGGATCAAGAGACGATAGAAAGACTACGATTTAGAGCTGCTAGACCGAAGTGGGTACAGGTTCCATCCAATCGTA
CACATGTCACGCCTGAAGGGAGTCAACGACACGAGCGAGCGACCGACAACCAGGCTAGTTGCATGCTTGGACGATACTAGTCGCTTCGACTTCGATGAGG
AACTCTTGCCAGAGGACAGTTGGGTCCCGGATGAAGAAAGCGGGCGATACGAAGTCGAAGCGATTTTGGATGACGATTTACGATTCTCGACGAGTACTGA
CAGGACACAACGGCAGTTCCTAATGAAGTGGAAGGGATACAAAGCACCAACGTGGGATCCGTTGTCAAATCTATCGTGTGGAGGGTTGTTGTTTGATAAC
CTACAGCAGAAGAAGTGCGATAACCGGTTGAAGATGGTGCAAGTAGCAGACGAGTTTTAACGCACTCTACGACACGAAAACACACGATCATCAATACTGA
GATGACCAGCAGGTGGGGATGGAAGGACTATTATCAAACGGTTCGTGTGTATTAAAAAACAAATGACAGCCATACTCCAAAGTGACTACTCGACAAGTCG
AAGAGGTACATGACGAGCTAACAAGTGGTGCTCAGATGTCGACGACAGCTCTTGCAGGTCCGCCAGACAACGGACTCGAATGCTGAGAAGGCTGAGACGA
GAAGATCTATGTACCACGACGATTATCCGGAAGAGGAGCGGACGAGTCAACATCAGGAGGAGCTGGTTCAGTCGAATCCACATCCTCGACGATACGGGGC
GTCACCTCGCTCTTGGCGATTCCCGCAAAAACAAATACAGGAAATTCAGGATGGCGGTAACAGAAGCAAGTGTTGTAGGGATGTTCCGCCGGCCGAGTCA
ACCACCATACCCGCTATGGTTCAACTATGTCCAACGCGTTGAGTTCACCAAACCAGTCAGGACCGGTAGACACAGAGGCGTGACTTACAAGCGGATAATG
CGGCACAG