Description :
From Genome Similarity Track
Location :
Scaffold_2102:2069- 3705
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2102-snap-gene-0.3Myosin

Sequence
1636 bases(100 bases per row)
AGGAGGGGGCACTAAAACACCTCAACATGCAACCTTCTGCATCCTTAGCATTGAAATGAGAGAAAAGGTTGCAATATGGGGGTTTACCGCGACATTTGTT
GGGCGAGCTACTGTGGTGTCGAGCGAATCCAGAAGTTTGATTGGCTAGTGACTATCCAATGAACGCGGCGGACGGCGCTGAATCAACACCAGAACTGCAG
TCCTGAAACGGCACATCGCGCAATCACCACTTCTGCTGGCAGAGGAAGGCTGCTCGCTCCACATGGCTTCATGGCGGCGCTTTCTGCTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTATGTGACGCAAACGCTGCTGTTGCATTCGCGAAAGTAGACACGAAACCATTTGGGCACAATGTAAGTGATAACCAACCCT
CCATCGACGTGGTGGTCACTGGCAAATGGAGCTCTGACGTTGAAGCCAATTCCAAAAAGCACCCGCAAGAGCAGGAAGCTACAATTGCTAAGTGCAACAA
AGCAGTCCTCTTTAAAGACATTAAGGATACTCTGCAGTCCGATGCACCATTTCTGTCGGTTGGTTTGGGTCCAGGATAGCAGGTCTTTAGAGTGCATCAG
TCTGGGCAACCCGCTTGTGAGGGATCCATGTCTACTTACGTGACGATCTACTTTATGAGAATAATAATGGCGTGCTGGGATATGTGAGAACACGTTGTGC
ACAGGCTGTCGATGTTGGTGGCGACCAAATGCATTAGACCGAGTAGCAAGACACCGAAAAGAAGAAACTAGAGAGGATCAGACAAAGGCAGCAAACGCGG
TCGGCTTCTCTCTTTAAAAAAAATCAAATCAAAATCACTCCACAAAAAACACACTCCTTTCTCGTCTTCCTTCTCGCGCCTTCTTCTTCTTCCTACATTA
TAAGTAACTCATTCTTTTCCACATGCATGCGCGGGTCTATCTCTTTCGACTCTTGTTGATCTCCAGGATAATGGACTGTAATTCAATGCACTGCTCGCGC
ATCAGCTCCAAATCGTACCGCAGGTTGCGGTTTTCGAGCTTCAGCATCGCATTCTCGTCTTCCAACGCAGTGCCGCTCGAACTCGATGTGCTCCCGCTAC
TTCTTCCTTTCATAAAGCTTTTCGCCTTCATCGAGAGCTCATCCATGCGCTTCAGGCTGTTTCGACTGCCCTTGCTAATGCTTCGAGTAGGACTGTATGA
AGCAGGATCATCGCCAAATCCTTCGTCATTGTCTGAATCGTCGGCTTCGTCAACCCATTCGCCGCCATCACTCTCTTCTTCACTTTCAGATTCGGGAGGC
AAGTACTCGATTGGAGTCTCGGTGTTCAGATACTTTCTCCAGCCTCGCTGGATTCGGACGATTGCGCGACGCTGGAAGAAATACTCTTTTCGCTCAAGTC
CCATGCGCATAACCGACTGAATTTTGATAATGGCATTGATCTTGTGGAAGAGCCGACGACGCTCAATAAATCCGAGCACAATCTTCTGGATGCAGGTTGC
CTCATAATACATGAAGTCCGACTTCATTGCTTCCAGCTCTTCCATCACACCATTCTTGAAGTAGATCAACGTTTTACCCATTTGATACTCCAGCGGAGAT
TTGCGGCCAATCAAATCCATAAAAATTGCCGACGTC