Description :
From Genome Similarity Track
Location :
Scaffold_2523:2069- 3334
Transcript NameFunction/comments
Phypl_g15170hypothetical protein PHYSODRAFT_327292

Sequence
1265 bases(100 bases per row)
GGTTGTCTCCGCTAAACGGTTAATCAGGAGCCCCGTCCCCGTTTCTATGCATGCTCGccctcttcttgctgctgttaTCTCCAGTGCCTTGGCGTTTCGC
TAATGGCGAATGTGCCGCCTCCGGTGACTTCTGCGGTAATGAGCAGACTGGTCCCAGTTGCTGTAACCCCGGAAATTAGTGGCAGCCCTGGAGCCCTTGG
CACTGCCAGTGCTGTTCGGAGTTCGCCCAGTGCACAACCCTGAGGTTGGTGCCAATTTCTACGGCGACGACCTCTTCGGAATGAAGCAACTGATGAATGT
TGCTCAAGTGCCGAGACGTCTGGATGCGCAGCGTTCACCTTTATCAACTGGGGCTGGATTGATAAGCACTGGCACGAAGAAGTGTATTCCGGCGATGGTA
GTGCACGACGGAGAACGGAGGCTAATGAGGTGCGGTAATACACGATGGGCATCTTGCTGTCCGACCGCCAACCCTGGAACTTGGTCTACTACCAGTGCAA
GGATGCGCTGTAGAAAGATGTGCCTGGTGATCAGGCCTGGTGCCAACAGTAAAACGCCATGAAGATCCTCCGAAAGACAAAAGGCACCGCTGCGTTCGAG
GCGGACTGCAAAACCTGGGTCACCGAGGCTGACATCAAGGAGGATCGCTGACGCCGGAGTGCTCAACACGGTTCGTGCTCTGGCCAGACACTGAATTTTT
TGGAGTTCATGGTGGACCGGAAGCAACTCGCCTACTGTAGCAACGCAGATATCACGGGCGGTTGGACGATCAACCGGACAGTGTCCGGTTGATCGTCCTG
TCCGGCGGACAGGGCGTTATCTGATCAGGAGTGGGTAACGAATCAAGCAAATGAAATATAGTTATACTAGATAACAGACGCAAAATGCTTGTCTTTTTGA
ATGGTGTTCGTTTTCGCATTTATCGTGGTAAAATGCGAATATGTGGAGTTTTTTTAATGGACCAGCGTTGTTCAAGTAGCAGATGTCAGTATGTCGCATT
AGCAGCGTTATTTCCAACAGATCTGAATCTCGCTGGCTTGCNGTAGAGGAAAGCCGTTTCCAATCCACGAAGCGTCGCTAGAGTCGGTTTGCTTCAATAT
CAACTGCTGTTATTATTTTTTTGGCTTATTGACGGTTGAAGCACAGCGGCCAcggctgctcgagcagttTGGTATTAACTTTCCAATTTGTTATCAAGAG
CCAAGGGGGTAACGGGCCGAAGAACTGTGAACGTTCCATTCCAACCCCTGTAGTGCACTGTGGAG