Description :
From Genome Similarity Track
Location :
Scaffold_252:20688- 22421
Transcript NameFunction/comments
Hyaar_Emoy2813196AlNc14C115G6505
Hyaar_Emoy2813197hypothetical protein

Sequence
1733 bases(100 bases per row)
GACTATGCGTTAGCTATGCTGCAGTACGAACAGTGCTGCTTATGTGGAGAAGGTGTTGTCGCTCACACGTTTTGTATTGGCCCGGTATCACCCCATGCTT
CGATTGACATTGTATCCAATACGACTGCTTCGGTGGAGGCGACAAACCCCGCACCCCTTTGAAAGCTTTGCTTCTTTACACACAAGAATGTATACATACC
ACGTCGAAATACTTATCCTTGGCCACGTGATAAGCTGCAATACACAACAACTCCTTCATGACTATAATAAGCTGCAGTACCACGACAAAGAAAAAAAATC
TATGCATCAATGGTGCTGCTGCTGCCTTTGTTTCCAAAAACAGCCGGACATCGAATTCTAGGCACTACCGCGCAAGGCCAAGGCGAACACGCACCTCGGT
CAATAGCGTTGCTGCTTTATTATTTTCGCAGCAGGGGATTCATAGTGAAGCTTTATCTGCGACAGCAACTTCTGCGCAATATTACCTTTGTCTTACGCAC
ATTAATCCCAGATGAACAGCTACTTGTAGCAACCAGCACGGTTACAACCAGTCAGCTAAAGTTTGGATTCATCGAGTCGAAGTGAATGTCAAACGGCAGT
CCGAGATCTTCATCATCCAGTATGCGAGACAGATGCGGTGGTCGCAATAACCCAGAAGCATCTCGGGACGGTGTGAATAGCGGAGGCATCGGGCCCCACA
GAAGGGGGACTGCCAGTCTTCCTCGCCGGTGAGCCTGCTGACGTTGGATGTACCCGCTAAGCCGACGCTCACGATCGTGTTGATTCCATACCTCCATTCT
CTTTTCATCGGTGTAACGTCTGACGTAAATAGCTTTTGTATCACCTCCAGATTGCAGCGCAACGCCATAGTCTACCAAAAAAGAGGGGTCAACAATCAAT
GAATGGTTTGTGACTGCAACTATTCAGCTATATAGCTATCCATAGCCGTACCACGCAGCAAAAAGTATTGCCACAGCTCGGACGAGTCGGTCAGCAGATG
AATATACTGCAGTTACGAAATAGTGGGAAATACAAATACGTGAGAATCAATTCTGGCTATCGAACTTGTTTTTCCGTACTTTGCTTGTCCCAGCGACTCG
GCAAAATTCTGGGGCTGTCAGAAAATTCCCAACACGCACAAGGAGCTGCTCCGGCAGACGATTTAGTTCTGCATCAGAAGGAATTATACTTCTGTTGCTT
GAGAATTCAGTAAATAAATTGCGCTGAAGTCTTTCGGCCACGACCAACAACAAAAGCGAAGTTAGAAACAATGCTACCTGCGGAAGCACCTCATCGGATT
GCATCTTACCTCCAGCGGAGAATTTCTAAGTAACCGCGCCATTTACCAGTATATAGCACTTGACCCTCATCCGGTCTTTGGTGATCCGTTTGCAGCCCTC
GGGGTTTCACGAACTCGGAAATCCTGTGACATGTAGTGGTCAGACACGGTACTAGATTTATGTAGTACTGTTTCGTCTACGCGATTGTACAAACGCACTT
GAGACTGATACGAACACTTTTGTCGATCGACACAAAGTGGACGAATAGTTTTGTGCCCACCATGAGCGCCCGAACGTGAACGTCTGTGCCGGTTTGACCT
ATTTTCGGCACTTTGTAGCATCGAGCCGGCAGCAGATTCACGTCGCCTGAAAAAACATAAATATTCTGTACACTATCTGCATCAGACTCAAGGCTAGGGG
GCATCCAATCATGCTCTTGTAACAAAGCACGCA