Description :
From Genome Similarity Track
Location :
Scaffold_17:206773- 210276
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007124Similar to RNF126: RING finger protein 126 (Bos taurus)
Pytul_DAOMBR144PYU1_G007123Protein of unknown function
Pytul_DAOMBR144PYU1_G007122Protein of unknown function

Sequence
3503 bases(100 bases per row)
CACGCACACGCACCTCGATGGCGTCACACGCGAGCGTGAAGAGCCAAGAGTGCCACATCTGCCTCGAAGAGCTCCGGCAGGACCTCGTGGCGTGCCCGTG
CGGCCACGTGTTCCACCACGCGTGCATCCTGCAGGCGCTGCAGGTGAACACGCAATGTCCGATCTGTCGCCGCTACGCAGCCGAGTCCCATTTGATCAGC
CTCTATTTCGATGTCCCGGGCGAGTCGCCAAGTGCTACGAATCAGAGCAATTCGTCGAGTGCCGGTAATGAAGCGAATGATAGAGATCCTAGTAGCGAAG
GAAGGCCAGCCGAGGAAGAAGCGCAGGTCGCGAAGCTCAATGAGCGTGTGAGTATGCTCGTGGAGCGCCTGCAGTGGCAGAAGAAACAGTACGACCTGCT
GATCGCCGAGATGAAGCGCGTGCGCCATCAGAGCGAGCAGCTCGTGATGGACAAGCAGGCGCTGATGCAGCGCGTGTCAAATTTAGAGGCGAACAAGAGC
GTGCTTGTGAATAAAGTGGCGAAATACCAAATCGAACTCAGCCGGCAGGCTGAACAGGCGCGCCAGACAGCGGTGAACCAGAGCATCATCAATTATCTGA
ACACGTGCGACGCCGAAGCCATGGAGGAAGAAATTCAGAACCCAAGAGAACTAATTATGGCGCTCAAGAAAGCTTGTAAGTATTGTGCGTATGCGTGCAT
GTGTTTGTATCGATCGCTTGCATCCCTAATTCACGATTATCTATGTGTGGCAGGCAAATTTCGTCATGACCAATATCAAAAGGTTGTCAAGGAAAAGACA
CGGTTAAAAGCAATGCTCCAGAGCGTCCAGCAGCATCCGCCGCATCACTCGCAGCAGCAGCAATTGCAACAGAAGGAGGACGATCGCATCGGCAAAGGCA
AACTGAAGGGCGGATTTAGCAACGGCAGCAGCAAGCGGCATTATTCGATGGACTACGCAAACACGGCGGCGCCACCGCACCCATTGGAGCTGAAAAAGCG
CAAAACCGATCCAAGCAGCTTAAATTCGATGCCAGCACCGTCACCCGCAGATTCTTCCGCGCCCGTACATTTCACGCCTCGAAATGAATCGGCTGGTTTC
CGCGCAAATGCATACTCAGATGTCTCCGTTCGCTCCGTGACCGCAGCGAGGCCAACATTTTCCAGAAGCAGCTTCAATCCGAATCAGTACGGCGCGTATA
ACCTCACGCCAGCGAACGAACCTTCAGTGCAGATGTCGAACCACACGGTGTGCCGAAGAGGATACGATGAAACAGGCAAGCTGACCAACTTTTTTCTCAC
AAAAGAGCCCAAACGAGGAGCTGCACACAGCGATCAACAGCAACAACAGAAGACGATTCCGAGCATGCAACACTTACTAGGAGTTCAGCATGGAGCGTCG
TCCAGTGCTCCAGTGGCGGCAAATCAGCGACCTGCTGGCGATCGACGAGAGTACGCGCTCACAAGCTGGTTACAGAAAGAATCTGCGTAGACAGATGCGG
GGAGCCACCACAGACTGTTCTATGATCTCGCCACGCCACTTGTTTTAAAGTTATACCTTGTGCTAGTTGCTGTTTTAAATTAATCTTGATTTTCTTGCTT
TGTCACGATCTTTATTAGTCTGTTGCTCGAGTATTTCGTTGTTTTACACCCAGAAGCTGTAAAGGAGGCGCGTCTTGAGAGCAGTTGGGTACTCTCCTGT
AGCAACCATTGTCTAGCGTCCTTGCATGGAGTAACTCGGCATGTGGTGGTGCTCTTATACTGGATCACGGAGTCAGTTTGATGTCTGAACCTGGAACTTT
TGATTTGTGGATTTGGGATTGAAGATGCTGAAGCGCGCGCTCAAGCTTCGTCTAGAAGGCAGGAGAGACATAGACGTCTCAGTGACAACAAACTGAAGAA
TAAATGGAGCTCATATTTCACAACGGCAGAGCTGTCTCCTCATGCCACATACCTGCTGCTCTCGAGCAAATTTTTGGACTTGTGGGTCTTCTGCTGGAAA
AGTCGGACTCGGAATCAGTAGACTCCCGATTTCTTCGATTGAGAAAAATCGAGTCTCACTTGATGCCACCTTTTCCTTCTCGTCTGCTGGTGGTGACGAT
ATAGCTTCTGGCTCCGGCCGGCTTGATAAGGAGATGCTGGACTTCCTCGCGATGCTGCTATTTGATTCTGGTGGAGGCACCGGCGATATGAGTCCACATA
TTTGGTATAGCATCGTCGCCAAGGCTTTTAAATTGGACGCTGTCTGTTTGCTCATGTTGCCAGATCCAATGTCAATTTCGTGTGGATGGAGGATGATGTG
AGGGATTAGAACGCGGACAAAGATGAAATTCACGATAACCACATTGAATCTTGAAATGACACTTGACATTGCCCCCGTAGTCGCGGATGCTGGCTCTGAT
AACAACGATCTTGTATCCATTTGGACCATATTTCGCGTTGCGCCAAACTCGTCGAACTCAAGTGCATCCCTCTCCTGTGAAAATACCATATACTGCAGTA
CACAAACAGAACCATTAGCCCACAACCGGCTATGCTGTTCACTAGCAGAGCGACGAAGTCACTTACAGTCTCTGGGAAATATACGCCATCTGAAGTGAGG
CGTCTCCAAAACTCCAGGATACCTGCTGGAACATCGTTCTTCTCAATGGCCTTGGCAATCGCATCGACAATTCCTTTCGCTCGCACTTTTAGTTTCACAA
ACCTCGCTTCGTCAAGCCCCTTCGTTCCTTGAGTTGATGGTGATCGAAGTGCAAACAAAGCTCCAAACTTGTTTGACAACCCTTTCGGTGGAGCTCTTGA
ACTAAGATCAAGGTTGAGTGAAGGCTCTTGAAGGATAGACATCAGCGGGTTGCGGACGATCTTTCCGAGCCAGACGCGAGTAGCACTGGAATAAATGTTC
AACATCGACTCAAAATCCTGAGGTTGATAAGGGCATAATATTTCACATTCTATTAGGCACGCATTGAATCCGTGCGACAGCGCACCAGATTAATAAAAAA
ACACTTACCTGCATGGCTTTTTCTTTTTGATCAAGTCGCTTTGTGCGGAGCAGTTTGCGAAGATGGACCAGCAGCAACACAGCATGGCTGACAGACCGAA
GAATCTGGATTTGCTTCATGGGTTCTGCATCTTCTTCATGGAAAGGAGATATCGATTCATTGTCGCGTTCCATCTCCAGTCGCCATCGTGGCTTTCGAAT
CGTGTTCCTGTTCGCGGACGCACGAATCAAGTTTTCAAGTCGCCTTCGACTTTCAGATCGGTCGCGTTGATTATCTTTACTTGAATCATCACCGCCCAGT
AGATTCTGTTGAGTGCTTGGATTGCTCGTCTTGCCGGTTTTATCCGGCATCAGCATCACGTCATCGTCAAGATTGCCAGAATTCTCCAACTTTTCAAGCA
TCTACATCGCAGTACATAACCATCAGTATAGTAAAAGGAAGCGAGAGTGGCCGAACGCGAGCGAACGTACGAGTTCATCTTCCTCGGTCCATTCAACCTC
GGG