Description :
From Genome Similarity Track
Location :
Scaffold_179:2066- 4185
Transcript NameFunction/comments
Hyaar_Emoy2811990hypothetical protein

Sequence
2119 bases(100 bases per row)
AATGCTACCTAAATCCTACAAGGTAAAGTATATGTTCAGCTAAGGGGCAGGGGCATAGATATTCGCTAATTAAAAGTCTCCCTCCTATAATTTATCCTAC
GATAATTTGTAATCTCAAGTAAATTATTAAATATGGCATCCACCGCGCTCGTTCTATAGGCGCAATATTACAATTTACAAGTCCTAAGCTATAATCAGCG
ACGAAAATCTGACTTTATATAATATATTGAGTATTTCATATTTTAAGAACGAAAACTACTTAAACACATGTAGAGGGTAGTTTGGGTAATGGGTGCAAGT
TGGAGGTCGCAGAGTAACATAAAAGCACCTTTATGAATTTCCTGGGATACATTAAGCAGATATCACGAAAACAGTTTGTTTTTTTCCGGATCTGGTGAAT
TCGTCTGCAACAAATGCCACATCTCCACTGTTTCTCACCCCAACTGAAGTCCTTTACCTTTTCTGGACTATCTTTCTCGGTATATCCGGATAAGCAGTCT
CATCCTCTTCGATGAGATCAAGAAACTCCGAAGTCGTCATGGGGTCCCGGATACGCATCTGCTCTAGCTGGTCTCTTAGCCCGCTTTCCGCCTCCTCAAA
CTCCTTCACAAAGGGCTCGTTCTAAGTAGCCACCAACTAGCGCATCGCAGTAATTCGGTCGACTCTTTAAATTTACCCGTGTCCTCACGGTCGTCACAAT
CGATGGCATTATGCAGATAATACTTGCGGCAGACCAACGTCGAGCAAAGAAAGCTTTTTGTTTATGTATTAAAAATCAGTATAATATAAAATGTATAGAG
AACCATATTATTAGTTTTAGCTGGCCACGCACCACCTGTTTTATACACCTTTGCAATTCATTACTGAAAGAACACGCCCTTCATCCAAGCATTTGTGTTC
TTTAAGTAAAGAAATGAATAATTGGTTGGCCTGACTTTGCTAATCGATAAAGAAAGGCTACAGATTGTCATATCAAGGCATTTGCAGTGAAAAAAATAGA
GGTTCGCGTCTGCAATGTATTTTACCACATACCTGTGTCAGGTAATAACAATAAGGCATACGTAAATCACATACTGTCATATTCTTGTGCACTACAATCT
CTTGCATAGCAATGTTCCTGACACGTGTTATTCTGTGGAACATTCCTACAGATTGCTTTGATTGGAATCCATTTCAAGTAATATTTACATAAAAATCCTA
TTGGTTTCATCCATGTTGTACATATCACATTTAGCGTGCTCGGCAATGATCTCCTTCAGATCGGGACGAGCTATACACGTAGTCTGCACTTCCAGCGCAC
CACTTTCACCGTGAATAGAATAGAATGGAGATCGTGATGTTGTTTAATCTTTGACCCTATCTGTTAGAAAAATGATGGAGTCATTAGGGGTTCCAAGTGA
TTGGACATGCTGCTCGGAGTTTGAGCAGATGAGGTCCCCGGTGATAAATTTCTGTGGTGTTGACACTACATAACTCAACCAGGACCCTAAATTCCAAAGC
CTTTTCCATTATAGGGTTTAAACAAGAAATTGGTAATTATCATTTAGACTTCGTGGATTCATGGTCGCCATATTATCCTGCTTTAATTTTATCTTACTTA
TTGATGCCTGTGACAGCGTTTTGACCGACCTCCTTCATTTCCCTAATCCATTTTCTTTAAAGACAATCCTGTATTTCCATCCTTGTTATGCCATATTTGC
ATTCGTTCCCCTTCATTAAGCCGGATTGCGACAGCTTCAAAAGTCTAGCTAGTACCTTAACAGGCAAGACACTGTTTGACACTGTTCAACACTGTTCAAC
ACTGTAAATTTGTATGAATCTTGCAATATCTCTATGTTGTAATTGCTATAAAGATGGGGAAACAAGTTGGCGACGTGCCGGCACCCCTAGGCACAGGTGT
AAAAAACAAGCAGCCTGAGAACGTTTAAGAACAATGTCGAAGAGAAAGTAGCATATTGGCCTAACGTCCATGCCGAAATCGATAGGTGATGTATCATATT
TGTTTAATTCTTCTAGTGTGTGTGCTTTTACCTTTTATTCACATGTTTTCATCTAATAACGGTTGGTGTAGCGAACTTCTTCTTATCTCGACGATGATAT
CTTCCCGATTCACCAGGAC