Description :
From Genome Similarity Track
Location :
Scaffold_2135:2066- 3791
Transcript NameFunction/comments
Phypl_g14719ATP-binding Cassette (ABC) Superfamily

Sequence
1725 bases(100 bases per row)
CATGGTGGCGGCAGGAAAACGACTGGGATGTGCCGCAGAAGCAAGGCGCTGCCTTGAAGACAGACACCACGACGACATTCACCAAGCGCGGATGTACCGT
TGAAGATTTGTAGGGACGCGAGCAGATACCGTAACAAACCGACTCGCCCGCTGTATCCCTTATTTTGCCAGTCAGTAACATAAGCTGCCATTTTGTTGAG
TTGCCACGCATGCTTCCTTTCAGCTTTCGACTGGCTGAATCATGTTGTTCAATCGAGCTGGAGATAACGACGTTTACCCAAACCCGAACTACGTGATCCC
CGTAGCTGTTCATGAGTGGCAGGACAAAAGTGTTGTCTGAGACCTGCCGCGTCAACCAACCTTGGCGGTACGATGGGGTTGCTGTGCGAACAGCAAGACT
CGGTATTCACACTGTCGGTAGACTCTACCGACAGTGTGAATACCGAGTCTATACCGTAGAGAGTCAAAGCCACCGGCACCGAtccagctacatgtacatg
taccatgATACTGATACCTATCGTACAGCCTGTAATGAACCTCCATAGCAAGCCTTACTCCTTTCAGCGGTCAGCTTATCTTATAAGTTGACACATTCCC
AAACTTTCTTGCTCCGCATCAAGCGCCCAAGATCCGCATCGTTGACCGAACCGAAGACTTCATCCAGCTATGCAGCTCTTTGCTCCGTTCctcgcagctt
gcgctcTGCTATCCTCTGGCGTTGCCTACAAGTCCGGCGAGGAGTCCAAATCCATCGACGACCTGTATGCTGACGCTGTCGCCGAAGGTGGCAACCTCGT
CCTATACCACGGCGGTGACACACCTACCCAGCAGGACGGGCTACACCAAGCTTTTTCGCAACGCTTTCCCAAAATCAACTTCACTGTAGTGGTCGACTAC
AGCAAATACCACGACGTCCGCATCGACAACCAACTGGAGACCAACACGCTTGTCcccgacgtggtggcgctccaAACACTTCAGGACTTCACTCGTTGGG
CCAAGACCGGTGATCTCCTCCCGTACAAGCCGGCCAACTTCTCCAAGGTCCACACGTCGTTGAAAGACAAGAATGGGGCGTGGTTGGCGTACACGATTTT
TACCTTCGGGTACATCTACAACTCGTCTGCGCTCAATGGGTTGGCGCCGCCTGCCACTCCGGCCGAGTTGGTGGACCCGCAGTATGCCGACAAGATTGCC
TCGTCTTACCCtaacgacgacgacgccgtgctgttCCTGTATACTCGCTACGTTGAGAAGTACGGCTGGGACTGGGTGGCCGAGATGGCCCAGCAGAACA
TTTCGTTCAACCGCGGTACAAACGTCGCCGGCGAACTTGTCAGCTCTGGAGAGAAGCCGATTGGCGTGGGgtcgggcggcggcggtggctccATTGAGTT
TGTGGGGGGCAATGGCACGGAGTACCTGAGCTGGGGACAGCGTGTTGGCATCCTCTCGAATTCCAAgcaccttgctgctgccaagctgTTCATGAACTGG
GCGATCTCCGAGGAAGCCCAGACGACGGTGGTGTTCAACAGTGTGCGCTCGGACCTCAACGCCAACAACCCTTGGGACACCCCGGAGGGCAACATGGCGA
CGTTCCCATTGTTCATGGAAGACcgcgccaaggtggagcagtGGAAGCAGACGTTCGCGCTGTACTTCGGCGAGGTGCAGGGCGAGCCCAGTCCTGGATT
CCTTGGTCTGCACCCCGGCCTTTGA