Description :
From Genome Similarity Track
Location :
contig_75:20650- 21880
Transcript NameFunction/comments
g9995.t1hypothetical protein F11D11.2 Caenorhabditis elegans

Sequence
1230 bases(100 bases per row)
TACACTCCTGGCCAAATTAATCCGGCCACCCACCTATTTGACCGTAGCTCAGCCAATTCTACAGATATGGCCCTGCGGTTTTGATATGTGTTTTGTATAG
TACAGAGAAGCACAGTGTTTGTGTTAACAATTGCGGTTTTGCGGTTTGTGCGGTAGCTCCCATACAATACACCGTTTTGGGTATGCGGTCCAAACTTCCG
GCCACCCGACCCATACTAAAATGAAGATATATGTAACGAAAAGATTGTATTAGTAATGCGTTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTCG
AGGCATTGAATCTATGAGCGTCGTTAGCGTAGCTTGATCAATGTTTTTCCACGCCGTCAATATAGCTGCTGTCAGGTCTCCAACATTAGCGTACTGGCGT
CCGTTGGGGTAGACTTTGCGAGCCAGCAACGCCCACAGGTTCTCGATGGGATTCAGGTCGGGTGAACGGGCAGGCCAATCGAGCACGTTCACTCCTTGCT
CTTCAGAGAACGCCTTTGTCTTCTGCGACATGTTAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCTTAGTTTAGGCGAGCATAGGGTAGCAA
GAACTCCGACACAGTGTAGATATACTGTGCCGAAGCCTGCCTCCCTATGAGCACCACGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCATC
ACAGAGTCTCTACCGTTCTGACGCCTCACTGTTGTCCTTGGCGGCCGTCTCACGTCGTGCCAGTAGCTTTGGAGGCCGTCGGGCCCGTCCAAGTTGAACT
TCTTTTCATCTGAAAAGATGATGCGCAGCCAGTCCTTCTTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGGTGGACCTTGTGCGCGGCTGTCAG
TGCCAGCGTGTTCTCCATCTTGATGTAGATTAGGCAGTCTACACCAGCAAGGAGACGCCGTATCGTGCGGGTGAGCACTTGCAGCTGCACTCTTCTTTCA
GCTGCGCGGCCGTGTAATCGCCGCTGGCCGCCTTGCGAAGCAGCAAACGGTCAAGCCTCTCTGACACAACGGGCTTCTTTCCGGGTCGGCGGCGATTTCG
GCGTGGCGCAGCAAGGGCTCGTTCAACTGCGTCGCGTGAGCACTTGACTCTTCTTGCAATAGCCCGGACCGAGAGCCCTCCTTCGTGTAGTCCTCGAATG
CGTCCTCTTTCCTCGTCGCTTAGCCAAGGC