Description :
From Genome Similarity Track
Location :
Scaffold_1538:2065- 3304
Transcript NameFunction/comments
Phymu_g13388hypothetical protein
Phymu_g13389putative polyprotein

Sequence
1239 bases(100 bases per row)
GGATGGTGGTGCCCCAAGGGCTCTCGaacgcaccagcaacgttCAATCGTCTTGTGACGCAGTTGTTCAGGCCCCATCGGGCGTACGCACAGACGTACTT
CGACGATATCTTCGTCCACAGTCGTGCAGAGCACGGTAGGTCGGATGTGAGAACCACATTGACCATTTGGGAGCGGTGCTTGAGCGCATGCGCACGAACA
AGCTGTACGCTAATGCAGATAAGTACATCTTGGGTGCCGACGAGATTATCTTCTTAGGGTGCTTCATCGGGAAGCGTGGTATTCGGGCAGATTCTGCTAA
GATCAAGGCCATTGTGGATTGGCCGGTTCCGATGAACCAGGACCTGAGGAAGTGACTGGGCCTAGCCAACTACTTGCACAAGTACAGCGCAAACTATGCG
GAGATGGCTCGGCCACTGTCTAATCTCCTTAAGAAGGATGCTGAGTGGTGCTGGGGCTCTAGTGAGCAAGGCGCCTTCGAGGCGGTTAAGGATAGTCTCC
TTCACGCTCCCATCCTGGCGTTGCCAGACCCTGATCGTCCCTTTAGTGTCGTCTGTGACGCATCGGACTTTGCCATCGGCAGTGCCCTGTTACAGGAAGA
CGCCGACGGGCGTGAACGCGTGATAGCGTTTGAGTCTCGGCAGCTGAAGGCTGCTGAGAAGAACTATCCAGTTCATGACAAGGAGCTACTTGCGATGAAG
TATGCCCTTGTCAAGTTCAGGGTTCACCTGCTCGGCTCCAAGCCATTCGTGATCTATACTGATCATGGGTCAATACGCACTGCGACACAGTCGNTACGCG
AGGCGAATGTTAACGATGAGTCGTGCATCGCGATGCTACGTGCTCTTGGGAGCAAGGAGTTTGAGAACTCGGACAGTAAACTGTCGGCGCGCATGCGCGC
AAGGCTCCATCGATACTCGCTCGATGGCGGCCTGttgtactacagtacagaTCTTAAAGACCCTCATCGTGTGGTTGTGCCTCATGACGAAGATCTCAAG
TGCCGTATCCTGTATGAGACTCGCGATACGCCGATCGGCGGGCACTTAGGTCGAGAGAAGACCTACAGCTCCGTGAGCACTCACTACTGGTGGCCCAAGA
TGAATAAGTGGGCGAGCACTTACGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGTCCTCTCCACATGCGGCGGCGCCGCTGTCGAGCCTGCCTGTGCC
CTCAGGGCTGTGGCAATCCATGAGTATGGACTTTGTGTT