Description :
From Genome Similarity Track
Location :
Scaffold_3558:2065- 3148
Sequence
1083 bases(100 bases per row)
CAGACACGTACACGGGCAAAATCTGTATCGCTGTGAACCCGTACCAGTGGCTGAACTTGTACGACAAGTCGATTATGGCCGGGTTCAGCGACGGCTCGCG
CGAGGGCAAGGCGCCCCATGTGTACGCCGTGTCCATGGAGGCGTTCACGAGTATGCGCAGCAAAGGGCAGAACCAGTCGATTCTCGTGAGTGGCGAGTCG
GGTGCCGGCAAGACCGAAACCACGAAGATTGTCATGTCCCACTTGGCGACGCTAGCCGAGAATTCCAACTCCAAGGTCATCCAGCAAATCATCCAGGCCA
ACCCGCTGCTGGAATCGTTTGGCAATGCGCAGACAGTGCGCAATGACAACTCGTCGCGGTTCGGTAAGTTCACGGAGCTCCAGTTTGGCGGTGACGGCAA
GCTCGTCGGTGCGTTTTCGCGCACGTACTTGCTGGAAAAGTCGCGTGTGACGACGCAGGCTCCCGGCGAGCGCAACTTCCACATCTTTTACCAGTTGCTC
AAGAAACGCGAACAGTACCCGGAGCTCGAGCTCGCGGCGTTTGACTCGTTCCACTATGTGTCGGGCAGCTCGCGTCAAGACAACTCGCCCGTCATGCCCG
AAGAAGGCGATCTCACGCGCACGAAGGAGGCGCTTGAATTGGTCGGCATTGGCGGTGACTTGCAGACCGAGATCTTGCGCATTCTTGCTGGTGTGCTCCA
CTTGGGTGAGACGCAATTCTCAGTCCGCAACGGAGATGTCGATGCGTCCCAGATCGTCGACATGAAGCCGTTCGAGACTGTGTGTCGTCTGCTGGGTGTC
GAGGTCGCGGCACTCGAACGTGCGATCTGCAACCGCAATGTCCACGTCGGCCGTGAAGTGTTTTTGAAGCCCATGACCCGTGACCAGGCGATCGACTGCC
GTGACGCGCTTGCCAAGAGCCTGTACTCCAAGCTCTTTTTGTGGCTCGTCGAGCAAATCAACGATACGATTGGCGCGAGCGCGAAGAACGCGTCATCATT
TATCGGCATCTTGGATATTTTCGGTTTTGAGCACTTCGAGAAGAACTCGTTTGAGCAGTTTTGCATCAACTATGCGAACGAGA