Description :
From Genome Similarity Track
Location :
Scaffold_1:20647- 23382
Transcript NameFunction/comments
Physo_127022hypothetical protein
Physo_127023reverse transcriptase

Sequence
2735 bases(100 bases per row)
GTACGGCTTGAGCAAGCCCACGTAGAAGATGGGGTGCGTCCGCATCTTCTTCGGAAGATTGAGCGTGTACGCAAGGCCCTCGTTGGCCACAACATTGAAA
GGTCCGATGAAGCGCGGGCGCAACTTCGTCTTGAAGACGGCAGACACTGCATGTGTAGGTAGGTTCTTAGCATTAAGCAGCACCAGGTCCCCGACCTCAT
AACTTTCAACATTGCCTCTGCTCCTGGCATCTGCATGTTCCTTTTGCTTGTCTTGGCTCTCAGCCATTGCGTCAGGCACATGTCGTAAGACACTCAGACG
CGTCGACAAGAAAGCGTCAACCTGTTTACGAATAGTAGCCGGACTGACATCGGCTAGCCGATCAGCTAAATCGGCTTCTCCTCCCCCACCAAGCCCGAGG
CCACCATCAGCGGGACGCGGGGATGAGACAAGCTGTTCACGTAGAACGGCGTGTAGCCTGTCGAGCCTTCACGGCGTTGTTCAACGCAAGCTCAATGAGT
GGCAGCATGGCGCTCCAGCGCTTCGGCGTCTCAGCGCAAATGCTGCGGAGCACGTCTTCGACGACGCGATTCACGCGCTCTGTCTGACCATCGGTCTGCG
GATGGTCTGCCGTGGACATGTCCAGCTTGGTGCCAAGCACCGCAAAGACCGCGCTCCAGAAGTGGCCCGTGAAGCGGGGGTCTCGGTCCGAGACAATCGA
CCCCGGGAGTCCGTGTTGTCGAAACACTCGGTCTAAGAACAGCGTTGCTGTACCTTTACCATCGATGGTATCCGGCACAGCCGCAATGTGAGCCATCTTG
CTCAGTCGGTCCATGAAGACCACGACTCCTGTGTTGCCCGTCGCGTCCGCCGGGCAGACCAAACACAAAGTCCATACTCATGGATTGCCAGCAGCCCGAA
GGGACAGGCAAACTCGCCAACGGCGCTGCAGCATGAGGTGACGACTTCACTCGCTGACACGTCTCGCACGTGCGCACATAAGTGCTCGTCCACTTATACA
TCTTCGGCCACCAGTAGTGGGTGCTCACCGAGCTGTAGGTCTTCTCACGGCCAAGATGGCCGGCCAGCGGCGTGTCGTGTGCCTCATAGAGGATGCGATA
CTTCCGATCCTCATCATGAGGGATGACCACGCGGGGCGTATCCTCGGGACCGGTGTTGTAGAAGAACAGGCCTCCATCGAGGGAATAACGGTGTAGCCGC
GCTGACAATTCTATGTCCGAGTCTTGAAACTCCTTGCTCCCCAGAGCTTTCAGCAACGCGACACAAGTGTCGTCCTTGGCATAAGCCGTTCGGATCAGAT
CCGGTAATGACGAAGGCACGGTCGTTACATGAGCCAGCTCATAATCCGGCCTGCGCGATAGCGCGTCCGCAAGGACATTCTGCCTGCCAGGCTTGTACTT
CACCTCGAAGTTGTACTCCGCGAAGACGAACAGCCAGCGGACCATCCTTTGCGAGAGATGAGGCGACTGAGTCGCCGTGCGTAACGACGCATGATCCGTG
TAAATCACGAACGGCTGAGAGCCCAACAGGTGAACCCTGAACTTGACGAGTGCATACTTCATTGCAAGTAGCTCCTTGTCGTGGACAGGATAGTTCTTCT
CCGCAGCCTTCAGCTGGCGAGATTCGAACGCCACCACGCGCTCGCGCCCCTCGGCGTCTGCTTGCAGCAGGGCACAGCCGATGGCAAAGTCCGAGGCGTC
ACAGACGACACTAAACGGACTAGCGGGGTCTGCCAGAGCCAGAATAGGCGCATGAAGGAGACTGTCCTTAATTGCCACAAACGCATCTTGATGCTCGGTG
TCCCAACACCACTCCGCATCCTTCTTCAGGAGATTGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCTAAGCCAA
GCCACTTGCGAAGATCCTTCTGGTTCTTGGGCACTGGCCAGTCAACAATGGCTTTGACCTTGACCGGGTCGGCCCTCAGGCCACGCTTCCCGATGAAGCA
CCCTAAGAAGGGGATATCTTCCGCTCCGAAGATGCATTTGTCAATGTTGGCGTACAACATGTTTTGACGCATGCATTCGAGCACTGCACGCAGGTGCTCC
ACATGGCTCTCCATATCAGTCTTTCCGTGCTCCGCACGACTGTGGACACAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATCGGGCCTGAAGAGCT
GCGTCACAAGCCGATTAAACGTCGCTGGCGCGTTCGAAAGCCCTTGGGGCATCACCAACCACTCCCAGAGCATGCCACTCGGAGTATTCACCGCAGTGAG
AGGGATGTCGCTCGTCCTCATGAGCAATTGGTAATATCCATCGACCAAGTCGAGCGCACTGTACATCGTGCATCCTGTCATGTTGTTCTGAAGAACATCC
TTCCGAGGAATCGGCGTCTGCGCCGGAATGGTAGCGGCATTCAGCTTGTTGAAAGCATACACGATACGCCACTTGCCATTCGGCTTTCTGACACAGAATG
TCGCCGTAGAGTGTGGAGATTTACTCTCACCCACCATGCCCGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCTTCGGCAAGGG
CCACTGCCTCGTCACGCAGTACTTCGTTCCCGGAACGAGATCGATTTCGTATCGAGCACCTCGATCCTGAGGTAGCCCCGAGGGCGGCTCCTTCGAGACC
ACGTCCTGGTAATCCTTTACCACTTGATACAAGGG