Description :
From Genome Similarity Track
Location :
Scaffold_7:2063311- 2064603
Sequence
1292 bases(100 bases per row)
GTCAACTTCCAACACTCCTCCTCGGTCGTCGCACTCTCGATCGCTCTTCAGTCCTTCAAGTTGAATATCTGCCGCAACTCGGCGATTCTCGGAGCAGGTA
GCGCCTTGGTGAGAAGATCCGCCATCATCAGCCGCGACTCCACGTACTCGGGCTTCACAGTCCCTTTCCTAGCGTAGTCACAGATGAACTTGATGCGGAT
GTCCACGTGCTTGGCGCTAGCCATGCTCTCCTCAGACTCCAGCTGCTTGATCGCAGCCTGGTTATCCATCTTCATAGGCACTGGCTCCACTACCTTGAAG
CCAAGCTCTTGTACCAGCTCCCGCAGTCCCAGCAGCTCGCGTCCGACGTGTGAGGCCGACGTGAACTCCGCCTCCATCGTGGAGAGCGCCACGCCGGTCT
GCTTCTTACAGATCCACTGCACTACAGCCCCGTCCATCGTCACGACTCCTCCGGACACCGACTTTCTGTCCCCTTTGTCGGCAGCGAAGTCGGCATCGCT
CCAGCTCTCTATCGCGACCATGCCGTCGCTCCTTGCAGACGCCTGCACGGTCAGCTTCAAGCTTTTCGTGCTCTTCAAGTACCTGGCAACCTTCTTGGCC
AGCTTCCAGTCGGTCGTGGTAGGCTGGTGCGTTCTCCGCGTGGCCTTGTGCACCGCGAAGCTGATGTCGGGCCTCGTACAACGTGCAATCCAGAGTAGGC
TCCCCACGAGCGACTGGAAGCTGCGGATCGCCGGCTCACCCGGGGATCCCGCCCTTTCCAGCAACTTCGGCTCGTTGCACACCGCCTCATTGCTCTCATC
GCCGACCTGGGTACGCACACCGTTCGCGTCCGCGAGTCCGTGCTGCTCGAGCAGCTCCTCAATCGTTGTCTGTTGATCCAGCGTGTAGCCCTCTTCCCTG
CTGAGATCCACACGCATACCGAGGAACTTCCTCACCTCTCCGAGGTCCTTCACTGACAGAACGCTCATGCACTGGAAGAAATCGTCCACCAGCTCCGGCT
TGGACGCGGTGACGAGCAGGTCGTCTACGTACACGCCCACGATCGTCATCTCGCCGTCCTCCCGCTTGTAGTACAGGCACATATCAGTCACGCAGCGCGT
GAAACCTGCCTCCACCAATTTAGCGTGCAACAGCTTGCTCCACAGCCGACCAGCCTGGCGCAGGCCGTACAGCGACTTCTTTAAGCGCAGCGCGAGCTCC
CCCTTGCCACTCGCACCCAACTTGCGCATCACCTCTTCGCTGATCACCATCCCCTGTGGGATCTTCAAGTATATCTCTAGGTGCTGCTCCTT