Description :
From Genome Similarity Track
Location :
Scaffold_1507:2063- 6732
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1507-fgenesh-gene-0.1Inositol polyphosphate multikinase
Pytir_DAOMBR486maker-pir_contig_1507-snap-gene-0.3DTDP-4-dehydrorhamnose reductase (ISS)
Pytir_DAOMBR486maker-pir_contig_1507-snap-gene-0.5GJ22975, partial

Sequence
4669 bases(100 bases per row)
CTGCAATTGCTTCAAGAGCTCCTGAAAGCAGTGGATGATCGTGCGGATGCCCTTGCGCACGCCCTCGTCTCGCTCCAGTGCATCAGAAGGGCGACGCGTC
ACGTGCGCAAAGTCAATCAGCCGGATGTCCCCAGCCAAAGCGCTAGCGAGTGCCGAATCGTCGCCATCATCGGCACCGTCGGCATTCTGGAGCGCGCTGT
CGTCGATTTCGCCATTGTAGAGGAACAGGAGGGAGCTCGCAATGAACTCGAGCTCCTGCTGCTCGTCAAACCACGCTCTCAGTAGCTCCAGGTGCAATAG
AAACTGGGCAAATCAATCATATGACCCAGTTAGAACTGCAACAATCTCTTACCAAAAGGAAGGGAATACATTCGTACCGCTTTGAGTAATACGATGTTCT
TGCGCTTGTCGCCCTCGTGGGTCGTGAAGAACTTCCCAAACGCCGGAATTAGGTCTTCTTGGGAGCGCACCTGGCGTCCAAAGTGCTTGTCGAGCTCAAT
GTACTGCTGATGCGCTGGATCGAACACTTTGATCCCCTGAATGCGGAAGCCCACGCGCTCCTGGAGCGGGAACTTTTGCTTCTCGTACGCGATTTTCTCG
GCGCTGGCGCCATCCTCGTACGAGCGCGTGCCGACCTTGACATCCATGATGCACGGCCAGTGTCTCCCCCACGTCAAGTCGTCCATCACTAGATGCTCTG
TGCAAACACACATCATTAATATTAGGGGTAAGCCAGCCACAACATCGATCCTGAAACATATCGGATACGTACTCCCATCGCGACTTTCACTGCCTGTTGA
TGCCGCGTCCACCTCATCGATGCCGTGCTCGCCAGTCGGGATCACCACCATGCCATGGTACCCAGGGATGAGCGGTCGGAGTTGTTCGAAGATCGGGTTT
GCACACTCTGTGCGGAACACCTGCTCGTAGAACTCGTGCTCGCGCTCTCCGCGGCGCTTGTTCTGGAAGGGCTTCAAGATCTTTCCGCCGTACGACTTCA
AGCCTGATGAGGACACACACAACACGTCAGTGCTTCGCAACATAGATGCAACAGCGTACATTATGGTGCCTTGTATGTACAAAGCGCCTTACTTGTCTTC
GCAGTCGCGTGACCGCCCACCTGGTGCGTCATCTCCACGAATCGCTCCACATCCGCCACCACGCGCGCTTCCTCTTCATGCTCTGCCATCTTTTTTGAGC
TTTTGAGTTGTTCAATTTGTGACTCAGACTCAGATATTTTAATTGCTAGACAGAATCATAATATGATTCCTGACAACGATTGCTGTTGAGCCAAATCCCA
AAAAGGCCAAAAGAAAATGATGACCCGCGTGCTGGTGCTGGGCGGCTCAAGCTACGTGGCACAGTTCATCCTGCAGCGTCACTTGGCAGCTGCATGTGGT
AGCGAGTACGATAGCGATAGCTTTGTCATGGCGTGCACCATGCGCGGGCAGCAAGCGTCGTCGTCTCCACTTCCTGCGGGGCTTGTGAGCGTCAGCACGA
CGACCGCGCCATCCTCACCTGCCGCCTCCAGCAGTTCGCAGGTTCGCGTGTACTGGGGCGTGGATCTCGGCACGATGGCGTCGGTGCGCGAGTGNNNNNN
NNNNNNNNNNNNNNNCCCGACGTGATCATCAACTGCGTGGGTGAGTGATGGTTTGTATTGCGGTAGCTTAGCTCTGTGTATGGGGTCCATTCTAATCTAC
TGCTCAATGCTGTGTTGCTGTTTTGTAGCAATGTCGTCACCTGCAGCGTGCGAGAAAGAGCCCGCGAGAGCCAAGGCGATCAATGAAGTGCGATTGCTAT
TGCTATCTACAACCGTCACAACAGAGCGATCATTATGAATAAGTGCTGACTCTCGTGGCTCATGGGTGTGTTGTTGTATGGAATGTGACGTGTTTTCAGC
CACGAGAGCTGGTTGAGTTCATCGGCGAAGAGCTCGAGTGGAAAGTTCGCTTTGTGCATTTCTCGACCGTGAGTCCCCTTTGCTGCACTACTAGAATCGC
TTGGCTTGCATGTGTGTTGCATAGCTCCTCACTGTTCATCATACTTTGATTGATATTGCACAGGATTTCGTATACGACGGAGCAAATCCGCCTCCACACG
GTTACAAAGAGAGCGATGCCGTCGAATCGCTCTCCTCGTCATCTTCAACAGATCCAGCAAGTCTCACAGTGTATGGCACGTCAAAACTCCGTTTCGACGC
GTTTTTACTTGCGCAACAGGGTAAATACGCCAATCTCAGCGGGCTCGTCCTTCGCATCGCGAACGTCATCGGCCCCCAAGCACCGCTATTTGCAGACCAG
CCGCCAAAGTTCATGGAGTGGCTGCACCAGAAGCTCTTTTACGACGCTAGCAAAGACGAAGAGACTCTGCCGTCGCAGCTCAGGCTCTGGAGCGACGAGG
TCCGATCATTCATTTACGTGCGCGACTTGGCAGCAATTGTCTTCGAGCTCTTGGAAAGGAGTGGGGATGACTCGTTCCAGGCAGCAACACCAACTTTGTC
GCCGTATTTCCTGCTGCTCAACATTGGTTTATGATGCTTTTTTTGGTATTGTGAGAGTTTGTCTTATCTGGAAACACTGACTCTCTTTCGTTTGTGTTGA
CTCCTCTTATAGGAGGCATCGACACGCTCTCGCGGGTGGAGCTCGCCAAAAGATATTGCGAGGCGTGTCAGCGCATCAATCCTCAAGGAATAACTTCACA
TGCTGTAATTGCTCCAACGTCGCGGACTTCAGTGGATCTCGGCTACCATCCGCCTCTAAATGCGTTTTTGAACACCGCTCGGCTACGTCAACAGCTCCCG
TCGCTTGCATTGACGCCTACAGACAGGATCATGGACGAGATCAGTCGCGAGCTCCTCACATAGTGAAAGACGTAAAGCACTTTGATGTCATTTTGGCTTT
TTTTTTATTAATCTGCGTGTCGATTTGTTGAAAATGAAAAAGGGAATTGGTGCAGCTTGCTAGTTTGCAGCAGCGGATAAAGAAAAAAGTGAAATACAAA
GTTCACAAGACGAAAGGGAAAAAAAGTGTACGTGCAAAGCACAACTTGAGCAGAGCGAACGCATGCCCCTTGCAGCATCAAGTTGTCTCAGGATCACACG
CCACGAGTAAGCGCTGCGAGAAACCCCAATTTACTCGAGCTCCATCACTTCACCCATCGCAATAGGAGCAAACTCCGCTGGCAACAGGTAGTCTGGACGT
TCAATTGCCTCCGTCACCTTTGGAGCTTCGACAAACGCGGCATCGCAAAGTGCGACAGAGTAGCACGCCTGGCTTGGACTCTTACCGCTCTGAACCAGCG
CGACTAGCTCATCAAACTTGGACGAAAGCACATCACATCGAGCGGCAGGAGGAAGGATGGTGCACATCGTCTCCAAAGCAACCTTTGCGAGGCGTAGCTC
GTTTTGATTCTTCGCCGCACGGGACGCCATCTCCGCCGTGTATTCACACAGCAGACAGCCCATTGTCATCGATTTCTCCGCCTCCACTGGCTTCGCAATC
TGATCCGTAGATTCGCACTCGTGGATACGAGTACAGATCGACTCGATGTCTTCGTTGTTCTTCAGAGCATCGATGATCGTGTCGTGATGCTTCATCAGTA
AGGTGCACTACAAATCAAACAAGAACATGGTTAATATCACGGTACACAGTATCATATCAGCATGTTCATGCGGCAGTTCATACCTCCTTCGAATCTGGAA
TCAAGCGGCAGATCGAGTTCATCTCAGCGGTGAAAGTCGCAAGACTCGCAGGCTTGGCAACCATCGAAGCAAGCAGCAACGAGTTCTGCTTGCAAATAGT
GCAGCGAGATGGAGACAGGCTTGAGTCCAAGAATTTCAGATCCGACAGCTTCACAGACGCAGCCTCGTCTGCACTGGTGCAGAACTTCAACGCTTGACAG
ATTTCATGTGGCGGCTTGCCGGACTTCAACTGTGACACTGCAGTGTCGAACATTTTCAAATCGGCGTGGCACTGTAAATGTGAACACAAACATTAGATCA
GCATCTGATTCAAGCACAAACGATAGTTCCCGAATGCATACCTTGTCATCGGATGGAAGCAGCCCGCAGACAATTCCCGCAGCTTCACGGGCTTCCTGAA
CTTCACCTGGGTTCTGGTTGAGGGCAAACTCCAAGACAGTGACAACACCGCTGCAGTACGCGCAAGAGTTGTTCCCCTTTCCTGAATTCTGAACTGGTGG
AGCCACCTCCTTCGTCTTCAAACCGCTCGCGTTCGCTTTGCAAAACTTCATATCATGGCAGATCGCCTTTGGCTTTTCACCCTTCTTGAGAGAATCAATC
ACCTTGTCCAATTCGTCCATGACAGGGCGGCACTTCACAACCACAACATAAAAAACAAGTCAGCAACAATACACACAACGTAGTAGAGGGAGTGTAGTAG
AATGTGAGGAGCGCACCTTCGACTCCGATGGGAGGAATCCACACACCAAATCTCCAATCTGACGAATCTGGTCGATCTGTGAAGGATCTTCAGCGAGGGC
AACTTCAAGAATACTCGCCAGCTGCGTGCAAACAAAGCACCCGTCAATTGCAGATTCCATGGAGTTCTTCACAATCTTGACAAGATGCTGGTCGAAAGAT
GCAAGATCTTCGATCCCGTGAGCGGTGCTCACAAGGGCTTTCGTCTTCGCATCACAGTACTTCAAGGAC