Description :
From Genome Similarity Track
Location :
Scaffold_21:206268- 210395
Transcript NameFunction/comments
Hyaar_Emoy2803588hypothetical protein

Sequence
4127 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTCAGCAATTCCAGAGATTCGGCGAGAAAGAAGACTCTGTTCTGTTTT
CTCTTTACTCGATGCTCAATCCACTCAGACAGACTATGACTGAGTCGGATTCGACTTCCTCCTGTAAACCAAGGCAAGGAAATTAACTCAGCAAACCCAG
TCATGTGGCGCCGCGGTCAAACAGACAACGGGAGATTGCGCTTCAACTCGCGAACACCTACCAAGTGGACGCAAAAGCTCGACGAGCAAAAGAGAACAAC
GAACAACTCAGCCCAGCCAAACGACGAAAGGTTCCAAGAACAGACCGACCTGAAACCACTACGGAGACAGATCGACAGGACGAAGAAGTGGATACACCAA
ACGATACTGGGTTCGGGGAAGGAGATTAAGTGTGGTTGTTTATGGAGAAGGTGAAGCTAGGATTAAGGAAAACGTTAGCTCACCGATGGCATGTCCCTTT
CCGGATCAAGAGACGATAGGAAGACTTCGATTTAGCTCACCGATGGCATGTCCCTTTCCGGATCAAGAGACGATAGAAAGACTACGATTTAGAGCTGCTA
GACCGAAGTGGGTACAGGTTCCATCCAATCGTACACATGTCACGCCTGAAGGGAGTCAACGACACGAGCGAGCGACCGACAACCAGGCTAGTTGCATGCT
TGGACGATACTAGTCGCTTCGACTTCGATGAGGAACTCTTGCCAGAGGACAGTTGGGTCCCGGATGAAGAAAGCGGGCGATACGAAGTCGAAGCGATTTT
GGATGACGATTTACGATTCTCGACGAGTACTGACAGGACACAACGGCAGTTCCTAATGAAGTGGAAGGGATACAAAGCACCAACGTGGGATCCGTTGTCA
AATCTATCGTGTGGAGGGTTGTTGTTTGATAACCTACAGCAGAAGAAGTGCGATAACCGGTTGAAGATGGTGCAAGTAGCAGACGAGTTTTAACGCACTC
TACGACACGAAAACACACGATCATCAATACTGAGATGACCAGCAGGTGGGGATGGAAGGACTATTATCAAACGGTTCGTGTGTATTAAAAAACAAATGAC
AGCCATACTCCAAAGTGACTACTCGACAAGTCGAAGAGGTACATGACGAGCTAACAAGTGGTGCTCAGATGTCGACGACAGCTCTTGCAGGTCCGCCAGA
CAACGGACTCGAATGCTGAGAAGGCTGAGACGAGAAGATCTATGTACCACGACGATTATCCGGAAGAGGAGCGGACGAGTCAACATCAGGAGGAGCTGGT
TCAGTCGAATCCACATCCTCGACGATACGGGGCGTCACCTCGCTCTTGGCGATTCCCGCAAAAACAAATACAGGAAATTCAGGATGGCGGTAACAGAAGC
AAGTGTTGTAGGGATGTTCCGCCGGCCGAGTCAACCACCATACCCGCTATGGTTCAACTATGTCCAACGCGTTGAGTTCACCAAACCAGTCAGGACCGGT
AGACACAGAGGCGTGACTTACAAGCGGATAATGCGGCACAGTTGACTCGAAATAAAGCTCCGGTTCGAGGACAGGGGCAGATCCACTCGGCAATCGCGTG
GTCACCGTCGCGTGGAGTGACTTGTCAAGAGTCTTCACTAACAGGCGGAGGACGTCACTCCGGCGCTTAAGAGCAAGGGAGTACTCAGACCATAGAGCGA
AAAGGGTAAACACCTCATCTGTCAGGCGCGTTGGGTCAAAATCCGGATGCAAGACCATCAAGACGCTTGAATCGACGATCCAGTGGCTTCACTCCCACAA
GGCAACGTAAATCTTGGAACGAGTGTCGGCCGATTTGCTTCGGTCAGAATCACGACCAGCCCCACGATATCGAACCCAAGCGTTGCATACTGCGTCGTGC
AGACTGCTGGGAGAAGTAGGCCGCCTG